[Bioc-devel] Fwd: Re: [devteam-bioc] suggestion about bioconductorpackage-- BSgenome.Hsapiens.NCBI.GRCh38
On 04/20/2014 10:41 AM, Martin Morgan wrote:
What's the sessionInfo() after getSeq? Herve patched Rsamtools during the last release cycle to address issues on Windows, perhaps the original report is using a non-patched version of Rsamtools?
I'm always forgetting to follow my own advice; I see consistent behavior with the following (as well as on my regular Linux machine across multiple versions of R: > getSeq(genome,'6',start=30000,width=50) 50-letter "DNAString" instance seq: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN > sessionInfo() R version 3.1.0 (2014-04-10) Platform: i386-w64-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_United States.1252 LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] parallel stats graphics grDevices utils datasets methods base other attached packages: [1] BSgenome.Hsapiens.NCBI.GRCh38_1.3.999 BSgenome_1.32.0 [3] Biostrings_2.32.0 XVector_0.4.0 [5] GenomicRanges_1.16.1 GenomeInfoDb_1.0.2 [7] IRanges_1.22.3 BiocGenerics_0.10.0 [9] BiocInstaller_1.14.1 loaded via a namespace (and not attached): [1] bitops_1.0-6 Rsamtools_1.16.0 stats4_3.1.0 tools_3.1.0 zlibbioc_1.10.0 >
Martin On 04/20/2014 07:39 AM, Michael Lawrence wrote:
Looks like a fairly serious bug with BSgenome: ---------- Forwarded message ---------- From: liyangbjmu <liyangbjmu at bjmu.edu.cn> Date: Sun, Apr 20, 2014 at 6:31 AM Subject: Re: Re: [Bioc-devel] [devteam-bioc] suggestion about bioconductorpackage-- BSgenome.Hsapiens.NCBI.GRCh38 To: Michael Lawrence <lawrence.michael at gene.com> Hi Michael, There is another problem with BSgeome.Hsapiens.NCBI.GRCh38. It can not always get the same sequence with getSeq command.
>library(BSgenome.Hsapiens.NCBI.GRCh38) genome<-BSgenome.Hsapiens.NCBI.GRCh38 > getSeq(genome,*'6',start=30000,width=50*)
50-letter "DNAString" instance seq: *GATGGCATCCAAGAAAGGGATGAGAATGTGAGATCCAGAAGGAAAAGCAG*
getSeq(genome,*'6',start=30000,width=50*)
50-letter "DNAString" instance seq: *TTGGAAGAAACAGGAAAACAGACCCTCAGAGACACAAAGGATGCTGAGAG*
getSeq(genome,*'6',start=30000,width=50*)
50-letter "DNAString" instance seq: *AGTGGCAGAGAGAAGAGTTGAAGGGGAGAAGTTGCTAGAACCTTGCTGCC*
getSeq(genome,'6',start=30000,width=50)
50-letter "DNAString" instance seq: CTCCTGCCCCCCTACCCTCACCTGGGTACCAGCCCAGGGGCCTCGGTCTG
getSeq(genome,'6',start=30000,width=50)
50-letter "DNAString" instance seq: CAAGGTCTGTAGTCCCTGCTGGATCTGCAGCAATGCCTGCATGGCTCGGG
getSeq(genome,'6',start=30000,width=50)
50-letter "DNAString" instance seq: GATTGGTAAGGATGGAGAGTGACTCTGGGTTCTGCATCTGGTGGGAAATA
> sessionInfo()
R version 3.1.0 (2014-04-10) Platform: i386-w64-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=Chinese_People's Republic of China.936 [2] LC_CTYPE=Chinese_People's Republic of China.936 [3] LC_MONETARY=Chinese_People's Republic of China.936 [4] LC_NUMERIC=C [5] LC_TIME=Chinese_People's Republic of China.936 attached base packages: [1] stats graphics grDevices utils datasets methods base Best, Sean 2014-04-20 ------------------------------ *Yang Li, PhD* Department of Occupational and Environmental Health Science School of Public Health, Peking University 38 Xueyuan Road, Beijing 100191, China ------------------------------ *????????* Michael Lawrence *??????????* 2014-04-17 05:15:10 *????????* Herv?_Pag?s *??????* liyangbjmu; maintainer; bioc-devel at r-project.org *??????* Re: [Bioc-devel] [devteam-bioc] suggestion about bioconductorpackage-- BSgenome.Hsapiens.NCBI.GRCh38 Another interesting aspect of 2bit is that it supports simple masking. I'm all for the 2bit direction. But then BSgenome would depend on rtracklayer? Or have you reimplemented it? On Wed, Apr 16, 2014 at 12:59 PM, Herv?? Pag??s <hpages at fhcrc.org> wrote:
Hi Sean [hope you don't mind if I cc Bioc-devel] On 04/15/2014 11:47 PM, Maintainer wrote:
Hi The Bioconductor Dev Team, A new package called BSgenome.Hsapiens.NCBI.GRCh38 has been available for one week. But the single-sequence.fa.gz file in this package is too big. The sequences of all the chromosomes are put together. It is difficult to load. Why do you remake this package as BSgenome.Hsapiens.UCSC.hg19 do? In BSgenome.Hsapiens.UCSC.hg19, sequence files for each chromosome are separated.
Yeah I know... sigh!! ;-) All the BSgenome data packages use this new on disk storage format, not just GRCh38. All the chromosomes are now put together in a single FASTA file compressed in the RAZip format (extension is rz, not gz). The file is indexed so it makes direct random access faster. So for example, extracting only some small portions of the genome with getSeq() is much faster than with the previous on disk storage format where the chromosomes were serialized into individual files. Some people have manifested interest in having getSeq() do fast random access to the genome sequences for a while. See for example this post from Michael in 2011: https://stat.ethz.ch/pipermail/bioc-devel/2011-May/002601.html I'm aware that the new on disk storage format slows down operations where you actually need to compute on the entire genome, which is typically done in a loop where one chromosome is loaded at a time. It's hard to beat the speed (and simplicity) of just loading the individual serialized DNAString objects in that case. This is unfortunate and I was a little bit worried about this when I pushed the new BSgenome packages to the public repos because I think this is a common use case. Note that the switch to this new format happened in devel in January and was announced on the Bioc-devel mailing list: https://stat.ethz.ch/pipermail/bioc-devel/2014-January/005150.html I was hoping people would test this and maybe start a discussion about whether this change was worth it or not. The good news is that I think we can have the best of both worlds i.e. fast direct random access and fast loading of the full sequences. I did some testing with the 2bit format and it looks very promising: - Random access is much faster than with current RAZip'ed FASTA format, - Loading a full chromosome into memory is also very fast because there isn't the overhead of decompressing the data. It could even be that it's faster than loading the chromosome stored in a serialized DNAString object, or maybe not, but at least it should be very close. - The sequences take less space on disk and the resulting BSgenome package will also be slightly smaller. It's something that I was planning to work on early in this new devel cycle. Seems like I should start even earlier and maybe backport to BioC release? Thanks, H. Best,
Sean 2014-04-16 ------------------------------------------------------------------------
________________________________________________________________________ devteam-bioc mailing list To unsubscribe from this mailing list send a blank email to devteam-bioc-leave at lists.fhcrc.org You can also unsubscribe or change your personal options at https://lists.fhcrc.org/mailman/listinfo/devteam-bioc
-- Herv?? Pag??s Program in Computational Biology Division of Public Health Sciences Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N, M1-B514 P.O. Box 19024 Seattle, WA 98109-1024 E-mail: hpages at fhcrc.org Phone: (206) 667-5791 Fax: (206) 667-1319 <%28206%29%20667-1319>
_______________________________________________ Bioc-devel at r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
[[alternative HTML version deleted]]
_______________________________________________ Bioc-devel at r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M1 B861 Phone: (206) 667-2793