How to load fasta file with openPrimeR?
Thank you. it looks like it worked: ```
fasta.file <- "stx.fa" seq.df <- read_templates(fasta.file) fasta.file
[1] "stx.fa"
seq.df
ID Header Group Identifier
Sequence_Length Allowed_Start_fw Allowed_End_fw
1 >MW311073.1 Escheric... >MW311073.1 Escheric... default 1
180 1 30
Allowed_Start_rev Allowed_End_rev Allowed_fw
Allowed_rev Allowed_Start_fw_ali
1 151 180 atgaagaagatgtttatggc...
cgctggaatctgcaaccgtt... 1
Allowed_End_fw_ali Allowed_Start_fw_initial Allowed_End_fw_initial
Allowed_Start_fw_initial_ali
1 30 1 30
1
Allowed_End_fw_initial_ali Allowed_Start_rev_ali Allowed_End_rev_ali
Allowed_Start_rev_initial
1 30 151 180
151
Allowed_End_rev_initial Allowed_Start_rev_initial_ali
Allowed_End_rev_initial_ali Sequence
1 180 151
180 atgaagaagatgtttatggc...
InputSequence Run
1 atgaagaagatgtttatggc... stx
```
When the original file stx.fa is:
```
MW311073.1 Escherichia coli strain XP2F shiga toxin 2 (stx2) gene, partial cds
ATGAAGAAGATGTTTATGGCGGTTTTATTTGCATTAGTTTCTGTTAATGCAATGGCGGCGGATTGCGCTA AAGGTAAAATTGAGTTTTCCAAGTATAATGAGAATGATACATTCACAGTAAAAGTGGCCGGAAAAGAGTA CTGGACCAGTCGCTGGAATCTGCAACCGTTACTGCAAAGT ```
On Mon, Feb 15, 2021 at 7:28 PM Bill Dunlap <williamwdunlap at gmail.com> wrote:
but if I give these commands to a local file:
```
fasta.file <- system.file("extdata", "IMGT_data", "templates",
"stx.fa", package = "openPrimeR")
fasta.file <- system.file("stx.fa", package = "openPrimeR")
```
where stx.fa il the file I wanted to open and that is present in the
working directly. I get only an empty object.
If "stx.fa" is in fact in the current working directory then use fasta.file <- "stx.fa" system.file() is for accessing files in installed packages. -Bill On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu <marongiu.luigi at gmail.com> wrote:
Hello, I am trying to load a fast file with the package 'openPrimeR'. The manual (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html) says to use: ``` fasta.file <- system.file("extdata", "IMGT_data", "templates", "Homo_sapiens_IGH_functional_exon.fasta", package = "openPrimeR") # Load the template sequences from 'fasta.file' seq.df.simple <- read_templates(fasta.file) ``` but if I give these commands to a local file: ``` fasta.file <- system.file("extdata", "IMGT_data", "templates", "stx.fa", package = "openPrimeR") fasta.file <- system.file("stx.fa", package = "openPrimeR") ``` where stx.fa il the file I wanted to open and that is present in the working directly. I get only an empty object. What am I getting wrong? Thank you -- Best regards, Luigi
______________________________________________ R-help at r-project.org mailing list -- To UNSUBSCRIBE and more, see https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Best regards, Luigi