Changing a for loop to a function using sapply

Hi,

With sapply():
fun3<-function(n){
?paste(t(sapply(random.string(n),randomizeString)),collapse="")
?}
?DNA3<-replicate(20,fun(21))
?DNA3
?#[1] "cttgcaatgtttaatcgttggagcagt"???????????????????????????????? 
?#[2] "tgcgttatcgcgcagagggccgtgagggat"????????????????????????????? 
?#[3] "ctggccgcatatgcacccacacgtacggcgacgccccatcttgtc"?????????????? 
?#[4] "tcaccagcccttcggaagtat"?????????????????????????????????????? 
?#[5] "gaaccgctggtgtaataacct"?????????????????????????????????????? 
?#[6] "caccaacaagtggattgtcactaattcccctatcagattaagggcgggttgtttgtg"?? 
?#[7] "ggcccaacg"?????????????????????????????????????????????????? 
?#[8] "actgcattcaacggattctgagggttctatataatcactcaataa"?????????????? 
?#[9] "ggattgatattcttaagcactcgcaataaccacctcgcctgccaccatggcaag"????? 
#[10] "actttaactagcttaagccgtaccacttcatct"?????????????????????????? 
#[11] "atagaacag"?????????????????????????????????????????????????? 
#[12] "ttgcatatcccctgagacagttatcgatct"????????????????????????????? 
#[13] "gacaacgatggtcgggtcagggaaaaaatc"????????????????????????????? 
#[14] "tgtgtaactggcaggtctcaacgccttcaaccaatc"??????????????????????? 
#[15] "atcgtcgcacgtgggtatggctaactt"???????????????????????????????? 
#[16] "ataagtcggaaatatggtatccgagtg"???????????????????????????????? 
#[17] "ttttgagcgctagcgaacttatatatatacggatct"??????????????????????? 
#[18] "ttcattatagttttctaaatgcagcagcacagatcaatattttgctctgcttcgttgtcc"
#[19] "cagggtgtactaggacgcgccccactcttgcattcgggc"???????????????????? 
#[20] "agcgacctaccgcccctccaataaagttgtcgttactgagtttcgcgccacgagttgttg"
? 
A.K.

----- Original Message -----
From: Rui Barradas <ruipbarradas at sapo.pt>
To: Ed <beary at geneseo.edu>
Cc: r-help at r-project.org
Sent: Sunday, October 21, 2012 3:50 PM
Subject: Re: [R] Changing a for loop to a function using sapply

Hello,

You're right an _explicit_ for loop is not necessary in your case, but note that the *apply functions are just for loops in disguise. They are also the prefered R idiom.
In this case I've used ?replicate, a function of the *apply family. To be more readable it uses a new function, called iteratively. I believe that the end result looks simpler than the explicit loop version, but that's a matter of taste.

# Changed from character vector to function
random.string <- function(n)
? ? rep(NA, rs <- sample(3:n, 1, replace = TRUE))

# Unchanged
randomizeString <- function(x) {
? ? DNAnucleotides<- c("a","c","g","t")
? ? a <- sample(DNAnucleotides, 3, replace = TRUE)
? ? return(a)
}

# Changed to use function random.string()
DNA <- character(20)
for(i in 1:20)
? ? DNA[i] <- paste(unlist(sapply(random.string(21), randomizeString, simplify = TRUE)), collapse = "")
DNA

# New function. Note the use of lapply, not sapply
fun <- function(n){
? ? paste(unlist(lapply(random.string(n), randomizeString)), collapse = "")
}

DNA2 <- replicate(20, fun(21))
DNA2

Hope this helps,

Rui Barradas
Em 21-10-2012 16:14, Ed escreveu:

Changing a for loop to a function using sapply

Thread (3 messages)