Performing basic Multiple Sequence Alignment in R?
I don't have an answer, trying to solicit more input with additional questions.
From: tal.galili at gmail.com Date: Tue, 21 Dec 2010 11:21:03 +0200 To: r-help at r-project.org; bioconductor at r-project.org Subject: [R] Performing basic Multiple Sequence Alignment in R? Hello everyone, I am not sure if this should go on the general R mailing list (for example, if there is a text mining solution that might work here) or the bioconductor mailing list (since I wasn't able to find a solution to my question on searching their lists) - so this time I tried both, and in the future I'll know better (in case it should go to only one of the two).
I take it you don't want an R interface for clustal and I seem to recall, from doing this a few years ago, that alignment by exact string matching was a bit of a research area ( I think you can find papers on citeseer for example). It does seem you are asking about exact string matches for alignment markers- your left sequences appear exactly someplace on the right- but your overall interests are not real clear. I never got my code fully working but I was happy that I could do different strains of e coli ( or something in the 5-10 Mbp genome range ) very quickly ( seconds as I recall ) and you could also presumably find similar items that had moved a long way. Earlier someone came here with a task and was pointed to bio packages but I thought there may be something in computational linguistics or mining better suited to needs but no one ever volunteered anything.
The task I'm trying to achieve is to align several sequences together. I don't have a basic pattern to match to. All that I know is that the "True" pattern should be of length "30" and that the sequences I'm looking at, have had missing values introduced to them at random points.
Alternatively I guess someone could make an R interface for various BLAST's, sometimes the help desk at NCBI can get questions like this to the right person internally.
Here is an example of such sequences, were on the left we see what is the real location of the missing values, and on the right we see the sequence that we will be able to observe. My goal is to reconstruct the left column using only the sequences I've got on the right column (based on the fact that many of the letters in each position are the same) Real_sequence The_sequence_we_see 1 CGCAATACTAAC-AGCTGACTTACGCACCG CGCAATACTAACAGCTGACTTACGCACCG 2 CGCAATACTAGC-AGGTGACTTCC-CT-CG CGCAATACTAGCAGGTGACTTCCCTCG 3 CGCAATGATCAC--GGTGGCTCCCGGTGCG CGCAATGATCACGGTGGCTCCCGGTGCG 4 CGCAATACTAACCA-CTAACT--CGCTGCG CGCAATACTAACCACTAACTCGCTGCG 5 CGCACGGGTAAGAACGTGA-TTACGCTCAG CGCACGGGTAAGAACGTGATTACGCTCAG 6 CGCTATACTAACAA-GTG-CTTAGGC-CTG CGCTATACTAACAAGTGCTTAGGCCTG 7 CCCA-C-CTAA-ACGGTGACTTACGCTCCG CCCACCTAAACGGTGACTTACGCTCCG