Skip to content

How to load fasta file with openPrimeR?

5 messages · Bert Gunter, Bill Dunlap, Luigi Marongiu

Original
Luigi Marongiu
# 
Hello,
I am trying to load a fast file with the package 'openPrimeR'. The
manual (https://www.bioconductor.org/packages/release/bioc/vignettes/openPrimeR/inst/doc/openPrimeR_vignette.html)
says to use:
```
fasta.file <- system.file("extdata", "IMGT_data", "templates",
                "Homo_sapiens_IGH_functional_exon.fasta", package =
"openPrimeR")
# Load the template sequences from 'fasta.file'
seq.df.simple <- read_templates(fasta.file)
```
but if I give these commands to a local file:
```
fasta.file <- system.file("extdata", "IMGT_data", "templates",
                "stx.fa", package = "openPrimeR")
fasta.file <- system.file("stx.fa", package = "openPrimeR")
```
where stx.fa il the file I wanted to open and that is present in the
working directly. I get only an empty object.
What am I getting wrong?
Thank you
Bert Gunter
# 
As this is a Bioconductor package, why not ask on their support page:

https://support.bioconductor.org/



Bert Gunter

"The trouble with having an open mind is that people keep coming along and
sticking things into it."
-- Opus (aka Berkeley Breathed in his "Bloom County" comic strip )


On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu <marongiu.luigi at gmail.com>
wrote:

  
  


  


      

    

    

      
      

        


  

        

      Bill Dunlap
    

    

      
      #
    

  


  

          

      
      
      
    

        
If "stx.fa" is in fact in the current working directory then use
   fasta.file <- "stx.fa"
system.file() is for accessing files in installed packages.

-Bill

On Mon, Feb 15, 2021 at 10:11 AM Luigi Marongiu

        
<marongiu.luigi at gmail.com> wrote:

            

      
      
      
    

        

      
      
    

  
  


  


      

    

    

      
      

        


  

        

      Luigi Marongiu
    

    

      
      #
    

  


  

      
I think the problem is system.file, which is R base, but I'll go for
bioconductor. Thanks

        
On Mon, Feb 15, 2021 at 7:18 PM Bert Gunter <bgunter.4567 at gmail.com> wrote:

            

      
      
      
    

        

      
      
    

        

  
    

      
      
    

  


  


      

    

    
6 days later

    

      
      

        


  

        

      Luigi Marongiu
    

    

      
      #
    

  


  

      
Thank you. it looks like it worked:
```

            

      
      
      
    

        
[1] "stx.fa"

            

      
      
      
    

        
ID                  Header   Group Identifier
Sequence_Length Allowed_Start_fw Allowed_End_fw
1 >MW311073.1 Escheric... >MW311073.1 Escheric... default          1
          180                1             30
  Allowed_Start_rev Allowed_End_rev              Allowed_fw
 Allowed_rev Allowed_Start_fw_ali
1               151             180 atgaagaagatgtttatggc...
cgctggaatctgcaaccgtt...                    1
  Allowed_End_fw_ali Allowed_Start_fw_initial Allowed_End_fw_initial
Allowed_Start_fw_initial_ali
1                 30                        1                     30
                         1
  Allowed_End_fw_initial_ali Allowed_Start_rev_ali Allowed_End_rev_ali
Allowed_Start_rev_initial
1                         30                   151                 180
                      151
  Allowed_End_rev_initial Allowed_Start_rev_initial_ali
Allowed_End_rev_initial_ali                Sequence
1                     180                           151
         180 atgaagaagatgtttatggc...
            InputSequence Run
1 atgaagaagatgtttatggc... stx
```
When the original file stx.fa is:
```

            

      
      
      
    

        
ATGAAGAAGATGTTTATGGCGGTTTTATTTGCATTAGTTTCTGTTAATGCAATGGCGGCGGATTGCGCTA
AAGGTAAAATTGAGTTTTCCAAGTATAATGAGAATGATACATTCACAGTAAAAGTGGCCGGAAAAGAGTA
CTGGACCAGTCGCTGGAATCTGCAACCGTTACTGCAAAGT
```

        
On Mon, Feb 15, 2021 at 7:28 PM Bill Dunlap <williamwdunlap at gmail.com> wrote: