Skip to content

codon usage bias

2 messages · aoife doherty, michael.weylandt at gmail.com (R. Michael Weylandt

Original
aoife doherty
# 
Hey guys, I have what i think is a really simple problem :(

I installed the seqinr library. I want to do an RSCU analysis.

But i can't get it to work in even the simplest case. for example, if i have
a string read in:
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"


and then i perform an RSCU analysis on it...
aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag
cat 
 NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
NA 
cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg
gct 
 NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
NA 
gga ggc ggg ggt gta gtc gtg gtt taa tac tag tat tca tcc tcg tct tga tgc tgg
tgt 
 NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA  NA 
NA 
tta ttc ttg ttt 
 NA  NA  NA  NA 


it's telling me that there are no codons. I'm not sure how to split up the
data or make this work at all.
Any help appreciated.

Aoife


--
View this message in context: http://r.789695.n4.nabble.com/codon-usage-bias-tp4431740p4431740.html
Sent from the R help mailing list archive at Nabble.com.
michael.weylandt at gmail.com (R. Michael Weylandt
# 
This question sounds more suited for the Bioconductor list which focuses on R tools for genetic/bioinformatic computation. It's an active and very friendly list and I think one doesn't have to subscribe to post (but doing so certainly isn't a bad idea).

Michael
On Feb 29, 2012, at 9:55 AM, aoife <aoife.m.doherty at gmail.com> wrote: