PEGAS: assignment to haplotype when missing information

Hi Hirra,

The assignment is not random, it follows the order of the sequences in the data:

- Seqs. A and B are compared and found to be identical so they are both assigned
to haplotype I.
- Seq. C is compared to haplotype I (effectively seq. A) and found to be
different so it is assigned to haplotype II.
- Seq. D is compared to haplotype I and found to be similar and so assigned to
haplotype I.

If you reorder your data and put Seq. C first, you'd obtain that C and D are
assigned to the same haplotype. The same issue occurs with ambiguous bases.

These situations certainly deserve to have an option to haplotype() to handle
them properly.

Best,

Emmanuel

----- Le 25 F?v 20, ? 19:31, Hirra Farooq hirra.farooq at postgrad.manchester.ac.uk
a ?crit :

Hello,

I am using the pegas R package to assign sequences into haplotypes.

I recently tried out a test examples with 4 sequences. 2 of the sequences (A and
B) are identical, 1 sequence (Seq C) differs from these at only one position
(pos 648).
The 4th sequence (Seq D) is identical to all but shorter so has no residues at
the determinant position 648. (See image below)

So correctly pegas assigns A and B to haplotype I and C to haplotype II. However
it also assigns D to I, despite there being no information at which residue is
at the determinant position.

I just wanted to know in such cases as D when there is missing information, does
pegas just randomly assign to a haplotype?




   aln (633..663)                  names
[A] CCCGATTTTATATCAACATTTATTT------
[D] CCCGATTTT----------------------
[B] CCCGATTTTATATCAACATTTATTT------
[C] CCCGATTTTATATCACCATTTATTTTGATTT


Thanks and best wishes,
Hirra
University of Manchester Student.

[[alternative HTML version deleted]]