Skip to content

R-help July 2008

|
cutting out numbers from vectors
3 msgs
calundergrad cutting out numbers from vectors Jul 31, 2008
Moshe Olshansky cutting out numbers from vectors Jul 31, 2008
Paul Roebuck cutting out numbers from vectors Jul 31, 2008
Help with hazard plots
3 msgs
Alan Cox Help with hazard plots Jul 31, 2008
Alan Cox Help with hazard plots Jul 31, 2008
Marc Schwartz Help with hazard plots Jul 31, 2008
Code to calculate internal rate of return
2 msgs
Thomas E Code to calculate internal rate of return Jul 31, 2008
Moshe Olshansky Code to calculate internal rate of return Jul 31, 2008
Is R's fast fourier transform function different from "fft2" in Matlab?
3 msgs
stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Jul 31, 2008
stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Jul 31, 2008
Coarsening the Resolution of a Dataset
9 msgs
Steve Murray Coarsening the Resolution of a Dataset Jul 26, 2008
jim holtman Coarsening the Resolution of a Dataset Jul 26, 2008
Steve Murray Coarsening the Resolution of a Dataset Jul 29, 2008
jim holtman Coarsening the Resolution of a Dataset Jul 29, 2008
Steve Murray Coarsening the Resolution of a Dataset Jul 30, 2008
Steve Murray Coarsening the Resolution of a Dataset Jul 30, 2008
jim holtman Coarsening the Resolution of a Dataset Jul 30, 2008
Steve Murray Coarsening the Resolution of a Dataset Jul 31, 2008
jim holtman Coarsening the Resolution of a Dataset Jul 31, 2008
sort rows of matrix by rows of another matrix
2 msgs
Mark Leeds sort rows of matrix by rows of another matrix Jul 31, 2008
Steven McKinney sort rows of matrix by rows of another matrix Jul 31, 2008
clustering and data-mining...
1 msg
Michael clustering and data-mining... Jul 31, 2008
allocMatrix limits
3 msgs
Vadim Kutsyy allocMatrix limits Jul 31, 2008
Brian Ripley allocMatrix limits Jul 31, 2008
Vadim Kutsyy allocMatrix limits Jul 31, 2008
multiple comparison
1 msg
Agus Susanto multiple comparison Jul 31, 2008
bwplot with Date object
2 msgs
GOUACHE David bwplot with Date object Jul 31, 2008
Deepayan Sarkar bwplot with Date object Jul 31, 2008
dput vs unclass to see what a factor really is composed of
3 msgs
Jacob Wegelin dput vs unclass to see what a factor really is composed of Jul 31, 2008
Brian Ripley dput vs unclass to see what a factor really is composed of Jul 31, 2008
Duncan Murdoch dput vs unclass to see what a factor really is composed of Jul 31, 2008
sort rows of matrix by rows of another matrix
2 msgs
Timothy W. Hilton sort rows of matrix by rows of another matrix Jul 31, 2008
Johnson, Eric A. (Seattle) sort rows of matrix by rows of another matrix Jul 31, 2008
instal tar.gz package on windows
4 msgs
georgiana onicescu instal tar.gz package on windows Jul 31, 2008
Marc Schwartz instal tar.gz package on windows Jul 31, 2008
Stefan Evert instal tar.gz package on windows Jul 31, 2008
Duncan Murdoch instal tar.gz package on windows Jul 31, 2008
anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
1 msg
Alessandro anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Jul 31, 2008
rollapply() to portions of a matrix
2 msgs
rcoder rollapply() to portions of a matrix Jul 31, 2008
Gabor Grothendieck rollapply() to portions of a matrix Jul 31, 2008
Problem with the installation of "install R" on Sun Solaris
1 msg
Survival statistics--displaying multiple plots
1 msg
'system' command through Rserve
2 msgs
Patil, Prasad 'system' command through Rserve Jul 31, 2008
Jeffrey Horner 'system' command through Rserve Jul 31, 2008
strip names lattice graphics
2 msgs
GOUACHE David strip names lattice graphics Jul 31, 2008
Deepayan Sarkar strip names lattice graphics Jul 31, 2008
History pruning
4 msgs
Ken Williams History pruning Jul 31, 2008
Duncan Murdoch History pruning Jul 31, 2008
Ken Williams History pruning Jul 31, 2008
Hadley Wickham History pruning Jul 31, 2008
Randomly drawing observations from factors.
2 msgs
Economics Guy Randomly drawing observations from factors. Jul 31, 2008
Marc Schwartz Randomly drawing observations from factors. Jul 31, 2008
upgrade to 2.5
2 msgs
Sundar Dorai-Raj upgrade to 2.5 Jul 31, 2008
Gabor Grothendieck upgrade to 2.5 Jul 31, 2008
vertical bpplot
1 msg
GOUACHE David vertical bpplot Jul 31, 2008
Query about finding correlations
1 msg
Stefan Grosse Query about finding correlations Jul 31, 2008
Query about finding correlations
1 msg
reference in article
1 msg
Peter Dalgaard reference in article Jul 31, 2008
How to output R image to a file?
1 msg
Aiste Aistike How to output R image to a file? Jul 31, 2008
Random number generation
7 msgs
Max Random number generation Jul 31, 2008
David Barron Random number generation Jul 31, 2008
Marc Schwartz Random number generation Jul 31, 2008
Jorge Ivan Velez Random number generation Jul 31, 2008
Patrizio Frederic Random number generation Jul 31, 2008
Max Random number generation Jul 31, 2008
Max Random number generation Jul 31, 2008
How to output R image to a file?
2 msgs
Aiste Aistike How to output R image to a file? Jul 31, 2008
Erik Iverson How to output R image to a file? Jul 31, 2008
rolling regression between adjacent columns
8 msgs
rcoder rolling regression between adjacent columns Jul 29, 2008
Gabor Grothendieck rolling regression between adjacent columns Jul 29, 2008
rcoder rolling regression between adjacent columns Jul 30, 2008
Gabor Grothendieck rolling regression between adjacent columns Jul 30, 2008
rcoder Re gression between adjacent columns - error with NAs Jul 30, 2008
Krzysztof Sakrejda Re gression between adjacent columns - error with NAs Jul 30, 2008
Gabor Grothendieck Re gression between adjacent columns - error with NAs Jul 30, 2008
rcoder Re gression between adjacent columns - error with NAs Jul 31, 2008
anisotrophy in fit.variogram problem
1 msg
Alessandro anisotrophy in fit.variogram problem Jul 31, 2008
Sampling two exponentials
6 msgs
Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 30, 2008
Ben Bolker Sampling two exponentials Jul 30, 2008
Moshe Olshansky Sampling two exponentials Jul 30, 2008
Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 31, 2008
Ben Bolker Sampling two exponentials Jul 31, 2008
Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 31, 2008
Coefficients of Logistic Regression from bootstrap - how to get them?
1 msg
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008
Identifying common prefixes from a vector of words, and delete those prefixes
3 msgs
Daren Tan Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008
John Kane Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008
Christos Hatzis Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008
hwriter - Writing R objects in HTML format
1 msg
Gregoire Pau hwriter - Writing R objects in HTML format Jul 31, 2008
Coefficients of Logistic Regression from bootstrap - how to get them?
5 msgs
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 30, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 30, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008
Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008
Mark Difford Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008
question about krige code in R
1 msg
Roger Bivand question about krige code in R Jul 31, 2008
Sperman Correlation with rcorr (Hmisc)
1 msg
Birgitle Sperman Correlation with rcorr (Hmisc) Jul 31, 2008
History pruning
4 msgs
Ken Williams History pruning Jul 30, 2008
Marc Schwartz History pruning Jul 30, 2008
Ken Williams History pruning Jul 31, 2008
Marc Schwartz History pruning Jul 31, 2008
Create an R package
3 msgs
FScottDahlgren Create an R package Jul 24, 2008
Gabor Grothendieck Create an R package Jul 24, 2008
FScottDahlgren Create an R package Jul 31, 2008
odds ratios in multiway tables (stratified)
4 msgs
Wim Bertels odds ratios in multiway tables (stratified) Jul 30, 2008
Marc Schwartz odds ratios in multiway tables (stratified) Jul 30, 2008
Wim Bertels odds ratios in multiway tables (stratified) Jul 31, 2008
Marc Schwartz odds ratios in multiway tables (stratified) Jul 31, 2008
tensor product of equi-spaced B-splines in the unit square
2 msgs
Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Jul 29, 2008
Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Jul 31, 2008
stats question
1 msg
Iasonas Lamprianou stats question Jul 31, 2008
Rearranging Data
1 msg
Jia Ying Mei Rearranging Data Jul 31, 2008
Identifying Points That Belongs to Components of Mixture Models
1 msg
Gundala Viswanath Identifying Points That Belongs to Components of Mixture Models Jul 31, 2008
Converting to subscripts and superscripts
2 msgs
naw3 at duke.edu Converting to subscripts and superscripts Jul 30, 2008
Ben Bolker Converting to subscripts and superscripts Jul 31, 2008
Significance of confidence intervals in the Non-Linear Least Squares Program.
1 msg
bbouling Significance of confidence intervals in the Non-Linear Least Squares Program. Jul 31, 2008
equivalent R functions for Numerical Recipes fitxy and fitexy ?
2 msgs
Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 27, 2008
Liaw, Andy equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 31, 2008
Identifying common prefixes from a vector of words, and delete those prefixes
1 msg
Richard Cotton Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008
nls weights warning message
3 msgs
Lisa Readdy nls weights warning message Jul 31, 2008
Brian Ripley nls weights warning message Jul 31, 2008
Brian Ripley nls weights warning message Jul 31, 2008
stats question
3 msgs
Iasonas Lamprianou stats question Jul 30, 2008
Moshe Olshansky stats question Jul 31, 2008
Marc Schwartz stats question Jul 31, 2008
bug in 'margins' behavior in reshape - cast
7 msgs
mfrumin bug in 'margins' behavior in reshape - cast Jul 30, 2008
Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 30, 2008
mfrumin bug in 'margins' behavior in reshape - cast Jul 30, 2008
Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 30, 2008
Michael Frumin bug in 'margins' behavior in reshape - cast Jul 31, 2008
Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 31, 2008
mfrumin bug in 'margins' behavior in reshape - cast Jul 31, 2008
combinations with replications
3 msgs
MarinaTarantini combinations with replications Jul 31, 2008
Jim Lemon combinations with replications Jul 31, 2008
ONKELINX, Thierry combinations with replications Jul 31, 2008
Location of HTML help files
1 msg
Keith Ponting Location of HTML help files Jul 31, 2008
OT:Selling Data Mining Cloud-A Concept
1 msg
ajay ohri OT:Selling Data Mining Cloud-A Concept Jul 31, 2008
random effects mixed model, different regressors
1 msg
Fensis random effects mixed model, different regressors Jul 31, 2008
add string
2 msgs
Alfredo Alessandrini add string Jul 31, 2008
john seers (IFR) add string Jul 31, 2008
multiple separators in scan() functions
2 msgs
milton ruser multiple separators in scan() functions Jul 30, 2008
Brian Ripley multiple separators in scan() functions Jul 30, 2008
High resolution graphics from R Windows Vista
2 msgs
Adam Langley High resolution graphics from R Windows Vista Jul 30, 2008
Brian Ripley High resolution graphics from R Windows Vista Jul 30, 2008
predict rpart: new data has new level
2 msgs
Chua Siang Li predict rpart: new data has new level Jul 30, 2008
Brian Ripley predict rpart: new data has new level Jul 30, 2008
Generic plot function for GLM objects
1 msg
Beat Huggler Generic plot function for GLM objects Jul 30, 2008
Rearranging Data
1 msg
Jia Ying Mei Rearranging Data Jul 30, 2008
colnames from read.table
2 msgs
Chua Siang Li colnames from read.table Jul 30, 2008
Erik Iverson colnames from read.table Jul 30, 2008
S 3 generic method consistency warning please help
4 msgs
stephen sefick S 3 generic method consistency warning please help Jul 30, 2008
Gabor Grothendieck S 3 generic method consistency warning please help Jul 30, 2008
stephen sefick S 3 generic method consistency warning please help Jul 30, 2008
stephen sefick S 3 generic method consistency warning please help Jul 30, 2008
High resolution graphics from Windows Vista
1 msg
Adam Langley High resolution graphics from Windows Vista Jul 30, 2008
curva PI
1 msg
Bruno P Masi curva PI Jul 30, 2008
Is conditional evaluation of R code chunks possible in Sweave ?
1 msg
Paul.Rustomji at csiro.au Is conditional evaluation of R code chunks possible in Sweave ? Jul 30, 2008
barplot for a categorial variable
2 msgs
kayj barplot for a categorial variable Jul 30, 2008
Bill Venables barplot for a categorial variable Jul 30, 2008
Unexpected line type in lattice plot key on pdf device
2 msgs
Gerrit Draisma Unexpected line type in lattice plot key on pdf device Jul 30, 2008
Deepayan Sarkar Unexpected line type in lattice plot key on pdf device Jul 30, 2008
Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE
3 msgs
Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 26, 2008
Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 27, 2008
Deepayan Sarkar Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 30, 2008
dotFirst option
2 msgs
Ferry dotFirst option Jul 30, 2008
Rolf Turner dotFirst option Jul 30, 2008
question about krige code in R
1 msg
Alessandro question about krige code in R Jul 30, 2008
john chambers R book
4 msgs
Mark Leeds john chambers R book Jul 30, 2008
Christos Hatzis john chambers R book Jul 30, 2008
Marc Schwartz john chambers R book Jul 30, 2008
stephen sefick john chambers R book Jul 30, 2008
setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile
4 msgs
Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008
Marc Schwartz setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008
Brian Ripley setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008
Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008
FFT - (STATS) - is this correct?
3 msgs
renata.camargo05 at ntlworld.com FFT - (STATS) - is this correct? Jul 30, 2008
stephen sefick FFT - (STATS) - is this correct? Jul 30, 2008
Rolf Turner FFT - (STATS) - is this correct? Jul 30, 2008
Rprintf will not build in my C++ compiler
3 msgs
nmarti Rprintf will not build in my C++ compiler Jul 30, 2008
Brian Ripley Rprintf will not build in my C++ compiler Jul 30, 2008
nmarti Rprintf will not build in my C++ compiler Jul 30, 2008
System exit codes
3 msgs
Ranjan Bagchi System exit codes Jul 30, 2008
Brian Ripley System exit codes Jul 30, 2008
Ranjan Bagchi System exit codes Jul 30, 2008
read XML
4 msgs
Paulo Cardoso read XML Jul 30, 2008
Martin Morgan read XML Jul 30, 2008
Paulo Cardoso read XML Jul 30, 2008
Martin Morgan read XML Jul 30, 2008
Re creating Procrustes Plot in Lattice
4 msgs
Andrewjohnclose Re creating Procrustes Plot in Lattice Jul 30, 2008
Gavin Simpson Re creating Procrustes Plot in Lattice Jul 30, 2008
Dylan Beaudette Re creating Procrustes Plot in Lattice Jul 30, 2008
Gavin Simpson Re creating Procrustes Plot in Lattice Jul 30, 2008
Setting fixed size for segement plot using stars() (axes size vs print size)
1 msg
Jay Douillard Setting fixed size for segement plot using stars() (axes size vs print size) Jul 30, 2008
Random subset
6 msgs
Alessandro Random subset Jul 30, 2008
John Kane Random subset Jul 30, 2008
Roland Rau Random subset Jul 30, 2008
Marc Schwartz Random subset Jul 30, 2008
Marc Schwartz Random subset Jul 30, 2008
Roland Rau Random subset Jul 30, 2008
Variable name in a String
2 msgs
R_Learner Variable name in a String Jul 30, 2008
Erik Iverson Variable name in a String Jul 30, 2008
System exit codes
1 msg
Ranjan Bagchi System exit codes Jul 30, 2008
correlation between matrices - both with some NAs
2 msgs
rcoder correlation between matrices - both with some NAs Jul 29, 2008
rcoder Re gression between columns in matrix - with some/full NAs Jul 30, 2008
best quad core configuration?
2 msgs
Alan Swanson best quad core configuration? Jul 30, 2008
Vincent Goulet best quad core configuration? Jul 30, 2008
About clustering techniques
5 msgs
pacomet About clustering techniques Jul 29, 2008
ctu at bigred.unl.edu About clustering techniques Jul 29, 2008
Christian Hennig About clustering techniques Jul 29, 2008
Christian Hennig About clustering techniques Jul 29, 2008
pacomet About clustering techniques Jul 30, 2008
Mixed effects model where nested factor is not the repeated across treatments lme???
3 msgs
M Ensbey Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008
ctu at bigred.unl.edu Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008
Mark Difford Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008
R -Legality Question about R's Open Source GNU GPL License
12 msgs
ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Martin Henry H. Stevens R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Roland Rau R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
(Ted Harding) R -Legality Question about R's Open Source GNU GPL Licen Jul 30, 2008
ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Gábor Csárdi R -Legality Question about R's Open Source GNU GPL Licen Jul 30, 2008
Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008
Hello,
1 msg
Kiran Annaiah Hello, Jul 30, 2008
OT: Data mining on demand .Using cloud computers.
1 msg
ajay ohri OT: Data mining on demand .Using cloud computers. Jul 30, 2008
~ . help
2 msgs
renata.camargo05 at ntlworld.com ~ . help Jul 30, 2008
Michael Dewey ~ . help Jul 30, 2008
FOURIER TRANSFORM HELP
1 msg
renata.camargo05 at ntlworld.com FOURIER TRANSFORM HELP Jul 30, 2008
Axes in perspective plot - persp()
1 msg
David Afshartous Axes in perspective plot - persp() Jul 30, 2008
Percent Change After Each Interval
1 msg
Jia Ying Mei Percent Change After Each Interval Jul 30, 2008
adding lines to multiple plot
4 msgs
Gary W adding lines to multiple plot Jul 30, 2008
Ben Bolker adding lines to multiple plot Jul 30, 2008
Gary W adding lines to multiple plot Jul 30, 2008
Ben Bolker adding lines to multiple plot Jul 30, 2008
Most often pairs of chars across grouping variable
3 msgs
svga at arcor.de Most often pairs of chars across grouping variable Jul 29, 2008
Marc Schwartz Most often pairs of chars across grouping variable Jul 29, 2008
svga at arcor.de Most often pairs of chars across grouping variable Jul 30, 2008
model mix problem. FALSE CONVERGENCE
1 msg
mergullo model mix problem. FALSE CONVERGENCE Jul 30, 2008
R command history -- can it be like Matlab's?
11 msgs
Michael R command history -- can it be like Matlab's? Jul 29, 2008
Brian Ripley R command history -- can it be like Matlab's? Jul 29, 2008
Hadley Wickham R command history -- can it be like Matlab's? Jul 29, 2008
Rolf Turner R command history -- can it be like Matlab's? Jul 29, 2008
Hadley Wickham R command history -- can it be like Matlab's? Jul 29, 2008
Michael R command history -- can it be like Matlab's? Jul 29, 2008
Spencer Graves R command history -- can it be like Matlab's? Jul 29, 2008
Martin Maechler R command history -- can it be like Matlab's? Jul 30, 2008
Gad Abraham R command history -- can it be like Matlab's? Jul 30, 2008
Bart Joosen R command history -- can it be like Matlab's? Jul 30, 2008
Michael R command history -- can it be like Matlab's? Jul 30, 2008
What's the best way to operate R from within Excel?
3 msgs
Michael What's the best way to operate R from within Excel? Jul 29, 2008
Patrizio Frederic What's the best way to operate R from within Excel? Jul 30, 2008
Michael What's the best way to operate R from within Excel? Jul 30, 2008
function to transform response of a formula
3 msgs
Paul Emberson function to transform response of a formula Jul 30, 2008
Paul Emberson function to transform response of a formula Jul 30, 2008
Paul Emberson function to transform response of a formula Jul 30, 2008
Connecting R to PostgreSQL on Windows.
1 msg
Andre Cesta Connecting R to PostgreSQL on Windows. Jul 30, 2008
"dens" function
1 msg
Shubha Vishwanath Karanth "dens" function Jul 30, 2008
Eclipse/Statet: How to set breakpoints
1 msg
Duncan Murdoch Eclipse/Statet: How to set breakpoints Jul 30, 2008
placing a text in the corner of a plot
6 msgs
Jörg Groß placing a text in the corner of a plot Jul 29, 2008
Jorge Ivan Velez placing a text in the corner of a plot Jul 29, 2008
Jörg Groß placing a text in the corner of a plot Jul 29, 2008
Rolf Turner placing a text in the corner of a plot Jul 29, 2008
Ben Tupper placing a text in the corner of a plot Jul 29, 2008
Jim Lemon placing a text in the corner of a plot Jul 30, 2008
adding lines to multiple plots
1 msg
Gary W adding lines to multiple plots Jul 30, 2008
png() does not generate a 24 bit PNG file
1 msg
Fán Lóng png() does not generate a 24 bit PNG file Jul 30, 2008
glm error: factor levels
1 msg
Birgitle glm error: factor levels Jul 30, 2008
Bizarre - R crashes on merge
3 msgs
Williams, Robin Bizarre - R crashes on merge Jul 30, 2008
Philipp Pagel Bizarre - R crashes on merge Jul 30, 2008
Philipp Pagel Bizarre - R crashes on merge Jul 30, 2008
table questions
4 msgs
Edna Bell table questions Jul 29, 2008
Patrizio Frederic table questions Jul 29, 2008
(Ted Harding) table questions Jul 29, 2008
Jim Lemon table questions Jul 30, 2008
Eclipse/Statet: How to set breakpoints
2 msgs
el_eli at gmx.de Eclipse/Statet: How to set breakpoints Jul 30, 2008
Duncan Murdoch Eclipse/Statet: How to set breakpoints Jul 30, 2008
Need help
2 msgs
Richard Cotton Need help Jul 30, 2008
Brian Ripley Need help Jul 30, 2008
Need help
2 msgs
renata.camargo05 at ntlworld.com Need help Jul 30, 2008
Brian Ripley Need help Jul 30, 2008
problem with read.table()
3 msgs
Birgitle problem with read.table() Jul 30, 2008
Philipp Pagel problem with read.table() Jul 30, 2008
Birgitle problem with read.table() Jul 30, 2008
need some help
2 msgs
Kurapati, Ravichandra (Ravichandra) need some help Jul 30, 2008
jim holtman need some help Jul 30, 2008
problem with nested loops
2 msgs
Jens Oldeland problem with nested loops Jul 30, 2008
Kenn Konstabel problem with nested loops Jul 30, 2008
R GUI help
1 msg
Tom.O R GUI help Jul 30, 2008
Repeated Measure ANOVA-Old question
5 msgs
ctu at bigred.unl.edu Repeated Measure ANOVA-Old question Jul 29, 2008
Mark Difford Re peated Measure ANOVA-Old question Jul 29, 2008
ctu at bigred.unl.edu Re peated Measure ANOVA-Old question Jul 30, 2008
Mark Difford Re peated Measure ANOVA-Old question Jul 30, 2008
Gavin Simpson Re peated Measure ANOVA-Old question Jul 30, 2008
Howto Draw Bimodal Gamma Curve with User Supplied Parameters
2 msgs
Gundala Viswanath Howto Draw Bimodal Gamma Curve with User Supplied Parameters Jul 29, 2008
Patrizio Frederic Howto Draw Bimodal Gamma Curve with User Supplied Parameters Jul 30, 2008
Successfully connected GNU R to PostgreSQL on windows XP.
1 msg
Andre Cesta Successfully connected GNU R to PostgreSQL on windows XP. Jul 30, 2008
Urgent
2 msgs
Yunlei.Hu at barclayscapital.com Urgent Jul 22, 2008
Moshe Olshansky Urgent Jul 29, 2008
Is there a better way to check if an element of a list exists than using match on names?
2 msgs
Paul.Rustomji at csiro.au Is there a better way to check if an element of a list exists than using match on names? Jul 29, 2008
jim holtman Is there a better way to check if an element of a list exists than using match on names? Jul 29, 2008
how to get the position of a vector-value
3 msgs
Jörg Groß how to get the position of a vector-value Jul 29, 2008
Katharine Mullen how to get the position of a vector-value Jul 29, 2008
jim holtman how to get the position of a vector-value Jul 29, 2008
rollapply() opertation on ts matrix
6 msgs
rcoder rollapply() opertation on ts matrix Jul 28, 2008
rcoder rollapply() opertation on time series Jul 28, 2008
Gabor Grothendieck rollapply() opertation on time series Jul 28, 2008
Gabor Grothendieck rollapply() opertation on time series Jul 28, 2008
rcoder rollapply() opertation on time series Jul 29, 2008
Gabor Grothendieck rollapply() opertation on time series Jul 29, 2008
Legality Question about R's Open Source GNU GPL License
5 msgs
David Henderson Legality Question about R's Open Source GNU GPL License Jul 29, 2008
Gad Abraham Legality Question about R's Open Source GNU GPL License Jul 29, 2008
Gad Abraham Legality Question about R's Open Source GNU GPL License Jul 29, 2008
David Henderson Legality Question about R's Open Source GNU GPL License Jul 29, 2008
Charles Annis, P.E. Legality Question about R's Open Source GNU GPL License Jul 29, 2008
Colors in Sweave
2 msgs
Satoshi Takahama Colors in Sweave Jul 27, 2008
Duncan Murdoch Colors in Sweave Jul 29, 2008
finding a faster way to do an iterative computation
5 msgs
dxc13 finding a faster way to do an iterative computation Jul 29, 2008
Rolf Turner finding a faster way to do an iterative computation Jul 29, 2008
Christos Hatzis finding a faster way to do an iterative computation Jul 29, 2008
Moshe Olshansky finding a faster way to do an iterative computation Jul 29, 2008
dxc13 finding a faster way to do an iterative computation Jul 29, 2008
Chi-square parameter estimation
2 msgs
Julio Rojas Chi-square parameter estimation Jul 25, 2008
Moshe Olshansky Chi-square parameter estimation Jul 29, 2008
Help interpreting density().
9 msgs
rkevinburton at charter.net Help interpreting density(). Jul 28, 2008
Bill Venables Help interpreting density(). Jul 28, 2008
Mark Difford Help interpreting density(). Jul 28, 2008
rkevinburton at charter.net Help interpreting density(). Jul 29, 2008
rkevinburton at charter.net Help interpreting density(). Jul 29, 2008
Mark Difford Help interpreting density(). Jul 29, 2008
rkevinburton at charter.net Help interpreting density(). Jul 29, 2008
Mark Difford Help interpreting density(). Jul 29, 2008
Bill Venables Help interpreting density(). Jul 29, 2008
try question
3 msgs
Edna Bell try question Jul 29, 2008
Brian Ripley try question Jul 29, 2008
Mike Prager try question Jul 29, 2008
optimize simultaneously two binomials inequalities using nlm
1 msg
emir.toktar at gmail.com optimize simultaneously two binomials inequalities using nlm Jul 29, 2008
ls() and memory question
2 msgs
Edna Bell ls() and memory question Jul 29, 2008
jim holtman ls() and memory question Jul 29, 2008
Graphics function question
4 msgs
Peter Flom Graphics function question Jul 29, 2008
Marc Schwartz Graphics function question Jul 29, 2008
Sarah Goslee Graphics function question Jul 29, 2008
Marc Schwartz Graphics function question Jul 29, 2008
combining zoo series with an overlapping index?
6 msgs
stephen sefick combining zoo series with an overlapping index? Jul 29, 2008
Gabor Grothendieck combining zoo series with an overlapping index? Jul 29, 2008
stephen sefick combining zoo series with an overlapping index? Jul 29, 2008
Gabor Grothendieck combining zoo series with an overlapping index? Jul 29, 2008
stephen sefick combining zoo series with an overlapping index? Jul 29, 2008
stephen sefick combining zoo series with an overlapping index? Jul 29, 2008
List names help
2 msgs
Rajasekaramya List names help Jul 29, 2008
Sarah Goslee List names help Jul 29, 2008
Flexible semivariogram in R (HELP)
1 msg
Alessandro Flexible semivariogram in R (HELP) Jul 29, 2008
accessing list elements
3 msgs
Paul Adams accessing list elements Jul 29, 2008
Sarah Goslee accessing list elements Jul 29, 2008
Erik Iverson accessing list elements Jul 29, 2008
Graphics function question
1 msg
Sarah Goslee Graphics function question Jul 29, 2008
Major Cloud Computing Testbed Announced at University of Illinois
1 msg
ajay ohri Major Cloud Computing Testbed Announced at University of Illinois Jul 29, 2008
Negative Binomial Regression
6 msgs
jcarmichael Negative Binomial Regression Jul 28, 2008
Ben Bolker Negative Binomial Regression Jul 29, 2008
Brian Ripley Negative Binomial Regression Jul 29, 2008
Ben Bolker Negative Binomial Regression Jul 29, 2008
Brian Ripley Negative Binomial Regression Jul 29, 2008
Ben Bolker Negative Binomial Regression Jul 29, 2008
Panel of pie charts
2 msgs
Richard Cotton Panel of pie charts Jul 29, 2008
Gavin Simpson Panel of pie charts Jul 29, 2008
try question
1 msg
Richard Cotton try question Jul 29, 2008
Removing script file
2 msgs
Dennis Fisher Removing script file Jul 29, 2008
Brian Ripley Removing script file Jul 29, 2008
more environment questions
4 msgs
Edna Bell more environment questions Jul 29, 2008
Gabor Grothendieck more environment questions Jul 29, 2008
Edna Bell more environment questions Jul 29, 2008
Gabor Grothendieck more environment questions Jul 29, 2008
Question regarding statisticians
1 msg
Max Question regarding statisticians Jul 29, 2008
Bootstraping GAMs for confidence intervales calculation
1 msg
Luis Reino Bootstraping GAMs for confidence intervales calculation Jul 29, 2008
subscript out of bounds help
1 msg
Rajasekaramya subscript out of bounds help Jul 29, 2008
lattice question
1 msg
Troels Ring lattice question Jul 29, 2008
biplot_group_colours_and_point_symbols
1 msg
Indermaur Lukas biplot_group_colours_and_point_symbols Jul 29, 2008
subscript out of bounds error.
1 msg
Rajasekaramya subscript out of bounds error. Jul 29, 2008
Case statements in R
9 msgs
Wade Wall Case statements in R Jul 28, 2008
Henrik Bengtsson Case statements in R Jul 28, 2008
Roland Rau Case statements in R Jul 28, 2008
David Katz Case statements in R Jul 28, 2008
Stefan Evert Case statements in R Jul 28, 2008
(Ted Harding) Case statements in R Jul 28, 2008
Henrik Bengtsson Case statements in R Jul 28, 2008
Patrick Burns Case statements in R Jul 28, 2008
Roland Rau Case statements in R Jul 29, 2008
writing the plots
3 msgs
Rajasekaramya writing the plots Jul 28, 2008
stephen sefick writing the plots Jul 28, 2008
John Kane writing the plots Jul 29, 2008
Panel of pie charts
2 msgs
Amin Momin Panel of pie charts Jul 29, 2008
John Kane Panel of pie charts Jul 29, 2008
keywords
2 msgs
Edna Bell keywords Jul 29, 2008
Charilaos Skiadas keywords Jul 29, 2008
How to set the parameters in Trellis Graphics (by Lattice package)
2 msgs
G.H. Zuo How to set the parameters in Trellis Graphics (by Lattice package) Jul 29, 2008
Felix Andrews How to set the parameters in Trellis Graphics (by Lattice package) Jul 29, 2008
Bug in sd() and var() in handling vectors of NA (R version 2.7.1)?
2 msgs
Marisa Laetitia Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Jul 29, 2008
Brian Ripley Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Jul 29, 2008
Installing BRugs
3 msgs
BXC (Bendix Carstensen) Installing BRugs Jul 29, 2008
Uwe Ligges Installing BRugs Jul 29, 2008
Brian Ripley Installing BRugs Jul 29, 2008
'for' loop, two variables
4 msgs
Oehler, Friderike (AGPP) 'for' loop, two variables Jul 29, 2008
Duncan Murdoch 'for' loop, two variables Jul 29, 2008
ONKELINX, Thierry 'for' loop, two variables Jul 29, 2008
Benno Pütz 'for' loop, two variables Jul 29, 2008
Is there way to multiple plots on gap.plot?
4 msgs
Arthur Roberts Is there way to multiple plots on gap.plot? Jul 28, 2008
Yasir Kaheil Is there way to multiple plots on gap.plot? Jul 28, 2008
Jim Lemon Is there way to multiple plots on gap.plot? Jul 29, 2008
Jim Lemon Is there way to multiple plots on gap.plot? Jul 29, 2008
optim fails when using arima
1 msg
MAIDER MATEOS DEL PINO optim fails when using arima Jul 29, 2008
stringdot ?
1 msg
renata.camargo05 at ntlworld.com stringdot ? Jul 29, 2008
mac install no font found problem in quartz display
1 msg
Zhesi He mac install no font found problem in quartz display Jul 29, 2008
product of successive rows
5 msgs
rcoder product of successive rows Jul 27, 2008
jim holtman product of successive rows Jul 28, 2008
Patrizio Frederic product of successive rows Jul 28, 2008
Moshe Olshansky product of successive rows Jul 29, 2008
Jorge Ivan Velez product of successive rows Jul 29, 2008
max
1 msg
Paul Adams max Jul 29, 2008
Problem reading a particular file with read.spss()
2 msgs
Chuck Cleland Problem reading a particular file with read.spss() Jul 29, 2008
Brian Ripley Problem reading a particular file with read.spss() Jul 29, 2008
list
2 msgs
Paul Adams list Jul 28, 2008
jim holtman list Jul 29, 2008
how to add notes to the graph?
3 msgs
rlearner309 how to add notes to the graph? Jul 28, 2008
Dieter Menne how to add notes to the graph? Jul 28, 2008
Jim Lemon how to add notes to the graph? Jul 29, 2008
Rf_error crashes entire program.
4 msgs
Andrew Redd Rf_error crashes entire program. Jul 28, 2008
Duncan Murdoch Rf_error crashes entire program. Jul 28, 2008
Andrew Redd Rf_error crashes entire program. Jul 28, 2008
Brian Ripley Rf_error crashes entire program. Jul 28, 2008
Is there anyway to clip the bottom of a barplot?
2 msgs
Arthur Roberts Is there anyway to clip the bottom of a barplot? Jul 28, 2008
Hadley Wickham Is there anyway to clip the bottom of a barplot? Jul 28, 2008
environment question
2 msgs
Edna Bell environment question Jul 28, 2008
Jeffrey Horner environment question Jul 28, 2008
"wave model" semivariogram
1 msg
Alessandro "wave model" semivariogram Jul 28, 2008
64-bit R on Mac OS X 10.5.4
1 msg
joseph 64-bit R on Mac OS X 10.5.4 Jul 28, 2008
Is there a way to avoid loading dependendent packages?
3 msgs
Paul.Rustomji at csiro.au Is there a way to avoid loading dependendent packages? Jul 28, 2008
Duncan Murdoch Is there a way to avoid loading dependendent packages? Jul 28, 2008
Henrik Bengtsson Is there a way to avoid loading dependendent packages? Jul 28, 2008
Mixed model question.
3 msgs
Rolf Turner Mixed model question. Jul 27, 2008
Douglas Bates Mixed model question. Jul 28, 2008
Rolf Turner Mixed model question. Jul 28, 2008
help with durbin.watson
2 msgs
tom soyer help with durbin.watson Jul 27, 2008
John Fox help with durbin.watson Jul 28, 2008
Link functions in SEM
3 msgs
Jeroen Ooms Link functions in SEM Jul 27, 2008
Stas Kolenikov Link functions in SEM Jul 27, 2008
John Fox Link functions in SEM Jul 28, 2008
RODBC to query an Oracle table
5 msgs
Megan J Bellamy RODBC to query an Oracle table Jul 28, 2008
Marc Schwartz RODBC to query an Oracle table Jul 28, 2008
Brian Ripley RODBC to query an Oracle table Jul 28, 2008
Jim Porzak RODBC to query an Oracle table Jul 28, 2008
David Scott RODBC to query an Oracle table Jul 28, 2008
Legality Question about R's Open Source GNU GPL License
8 msgs
zerfetzen Legality Question about R's Open Source GNU GPL License Jul 28, 2008
Jim Porzak Legality Question about R's Open Source GNU GPL License Jul 28, 2008
Patrick Burns Legality Question about R's Open Source GNU GPL License Jul 28, 2008
Duncan Murdoch Legality Question about R's Open Source GNU GPL License Jul 28, 2008
Roland Rau Legality Question about R's Open Source GNU GPL License Jul 28, 2008
Marc Schwartz Legality Question about R's Open Source GNU GPL License Jul 28, 2008
zerfetzen Legality Question about R's Open Source GNU GPL License Jul 28, 2008
(Ted Harding) was: Re: Legality Question about R's Open Source GNU GPL License Jul 28, 2008
multiv
2 msgs
Somesan, Ileana multiv Jul 28, 2008
Mark Difford multiv Jul 28, 2008
Fill in NA values in vector with previous character/factor
6 msgs
Owen Jones Fill in NA values in vector with previous character/factor Jul 28, 2008
Gabor Grothendieck Fill in NA values in vector with previous character/factor Jul 28, 2008
Dimitris Rizopoulos Fill in NA values in vector with previous character/factor Jul 28, 2008
Yasir Kaheil Fill in NA values in vector with previous character/factor Jul 28, 2008
Bert Gunter Fill in NA values in vector with previous character/factor Jul 28, 2008
Christos Hatzis Fill in NA values in vector with previous character/factor Jul 28, 2008
loop does not work
2 msgs
aude Valade loop does not work Jul 28, 2008
Sarah Goslee loop does not work Jul 28, 2008
How to unsubscribe?
2 msgs
Endre Domiczi How to unsubscribe? Jul 28, 2008
Marc Schwartz How to unsubscribe? Jul 28, 2008
RStem with portuguese language
2 msgs
Paulo Cortez RStem with portuguese language Jul 28, 2008
Duncan Temple Lang RStem with portuguese language Jul 28, 2008
Help with a loop
3 msgs
Sofia Martinez Help with a loop Jul 27, 2008
Patrick Burns Help with a loop Jul 28, 2008
Sofia Martinez Help with a loop Jul 28, 2008
Overlay of simple plots
2 msgs
Phillip R. Hunt Overlay of simple plots Jul 28, 2008
stephen sefick Overlay of simple plots Jul 28, 2008
Using PrettyR to produce LaTeX output
6 msgs
jcarmichael Using PrettyR to produce LaTeX output Jul 23, 2008
Austin, Matt Using PrettyR to produce LaTeX output Jul 23, 2008
Gabor Grothendieck Using PrettyR to produce LaTeX output Jul 23, 2008
Jim Lemon Using PrettyR to produce LaTeX output Jul 24, 2008
jcarmichael Using PrettyR to produce LaTeX output Jul 28, 2008
jcarmichael Using PrettyR to produce LaTeX output Jul 28, 2008
Question about the SSOAP package
1 msg
Aiste Aistike Question about the SSOAP package Jul 28, 2008
in axis() suppressing axis line but keeping tick marks
1 msg
Brian Ripley in axis() suppressing axis line but keeping tick marks Jul 28, 2008
Color of box frame in Legend (Was: Matrix barplot)
3 msgs
Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008
Nutter, Benjamin Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008
Brian Ripley Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008
Converting from char to POSIX:
2 msgs
Agustin Lobo Converting from char to POSIX: Jul 28, 2008
Brian Ripley Converting from char to POSIX: Jul 28, 2008
Bootstrapping
1 msg
laila khalfan Bootstrapping Jul 28, 2008
how to export ".xls" file with colorful cells?
4 msgs
XinMeng how to export ".xls" file with colorful cells? Jul 23, 2008
Marc Schwartz how to export ".xls" file with colorful cells? Jul 24, 2008
Gabor Grothendieck how to export ".xls" file with colorful cells? Jul 24, 2008
Kevin Wright how to export ".xls" file with colorful cells? Jul 28, 2008
speeding up loop and dealing wtih memory problems
5 msgs
Denise Xifara speeding up loop and dealing wtih memory problems Jul 28, 2008
David Hajage speeding up loop and dealing wtih memory problems Jul 28, 2008
jim holtman speeding up loop and dealing wtih memory problems Jul 28, 2008
ONKELINX, Thierry speeding up loop and dealing wtih memory problems Jul 28, 2008
Brian Ripley speeding up loop and dealing wtih memory problems Jul 28, 2008
S4 : setGeneric for classical methods
9 msgs
Christophe Genolini S4 : setGeneric for classical methods Jul 22, 2008
Brian Ripley S4 : setGeneric for classical methods Jul 22, 2008
Christophe Genolini S4 : setGeneric for classical methods Jul 22, 2008
Martin Maechler S4 : setGeneric for classical methods Jul 23, 2008
Christophe Genolini S4 : setGeneric for classical methods Jul 26, 2008
Martin Maechler S4 : setGeneric for classical methods Jul 26, 2008
Christophe Genolini S4 : setGeneric for classical methods Jul 27, 2008
Martin Maechler S4 : setGeneric for classical methods Jul 28, 2008
Christophe Genolini S4 : setGeneric for classical methods Jul 28, 2008
Rv: Chi-square parameter estimation
1 msg
Julio Rojas Rv: Chi-square parameter estimation Jul 28, 2008
Converting english words to numeric equivalents
12 msgs
oscar Linares Converting english words to numeric equivalents Jul 27, 2008
Rolf Turner Converting english words to numeric equivalents Jul 27, 2008
Barry Rowlingson Converting english words to numeric equivalents Jul 28, 2008
Baptiste Auguie Converting english words to numeric equivalents Jul 28, 2008
(Ted Harding) Converting english words to numeric equivalents Jul 28, 2008
Baptiste Auguie Converting english words to numeric equivalents Jul 28, 2008
Hans-Jörg Bibiko Converting english words to numeric equivalents Jul 28, 2008
Hans-Jörg Bibiko Converting english words to numeric equivalents Jul 28, 2008
Paulo Cardoso Using stop ( ) from a Text Editor Jul 28, 2008
jim holtman Using stop ( ) from a Text Editor Jul 28, 2008
Brian Ripley Using stop ( ) from a Text Editor Jul 28, 2008
Paulo Cardoso Using stop ( ) from a Text Editor Jul 28, 2008
parametric bootstrap
1 msg
laila khalfan parametric bootstrap Jul 28, 2008
randomSurvivalForest 3.5.0 now available
1 msg
Udaya B. Kogalur randomSurvivalForest 3.5.0 now available Jul 28, 2008
axis.break on Date-x-axis in lattice xyplot
3 msgs
Henning Wildhagen axis.break on Date-x-axis in lattice xyplot Jul 28, 2008
Ben Bolker axis.break on Date-x-axis in lattice xyplot Jul 28, 2008
Jim Lemon axis.break on Date-x-axis in lattice xyplot Jul 28, 2008
Help with yaImpute
1 msg
Wesley Roberts Help with yaImpute Jul 28, 2008
Percentile Estimation From Kernel Density Estimate
2 msgs
Jeffrey_Bromaghin at fws.gov Percentile Estimation From Kernel Density Estimate Jul 25, 2008
Karl Ove Hufthammer Percentile Estimation From Kernel Density Estimate Jul 28, 2008
I can not see help.start() in Ubuntu.
1 msg
xiaopeng hu I can not see help.start() in Ubuntu. Jul 28, 2008
Transfer Function Modeling
2 msgs
Ashish Kumar Transfer Function Modeling Jul 26, 2008
Felix Andrews Transfer Function Modeling Jul 28, 2008
graphing regression coefficients and standard errors
3 msgs
Murali K graphing regression coefficients and standard errors Jul 25, 2008
Ritwik Sinha graphing regression coefficients and standard errors Jul 27, 2008
Mark Difford graphing regression coefficients and standard errors Jul 28, 2008
How to set directory Rscript runs in/Sweave output directory
2 msgs
Paul.Rustomji at csiro.au How to set directory Rscript runs in/Sweave output directory Jul 27, 2008
Brian Ripley How to set directory Rscript runs in/Sweave output directory Jul 27, 2008
Are there any packages that can process images other than pixelmap (i.e. pnm)?
2 msgs
Arthur Roberts Are there any packages that can process images other than pixelmap (i.e. pnm)? Jul 27, 2008
Henrik Bengtsson Are there any packages that can process images other than pixelmap (i.e. pnm)? Jul 27, 2008
read.table question
2 msgs
Edna Bell read.table question Jul 27, 2008
Rolf Turner read.table question Jul 27, 2008
Coefficients of Logistic Regression from bootstrap - how to get them?
27 msgs
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
刘杰 Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
(Ted Harding) Coefficients of Logistic Regression from bootstrap - how Jul 21, 2008
Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
N. Lapidus Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Bert Gunter Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Marc Schwartz Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Rolf Turner Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Michal J. Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008
Mark Difford Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Johannes Hüsing Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Tim Hesterberg Coefficients of Logistic Regression from bootstrap - how to get them? Jul 27, 2008
Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object)
2 msgs
stephen sefick Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) Jul 27, 2008
Gabor Grothendieck Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) Jul 27, 2008
Maximization under constraits
1 msg
Ritwik Sinha Maximization under constraits Jul 27, 2008
Rolling regression - o/p selected coefficients
1 msg
rcoder Rolling regression - o/p selected coefficients Jul 27, 2008
Object-oriented programming in R for Java programmers?
1 msg
Satoshi Takahama Object-oriented programming in R for Java programmers? Jul 27, 2008
Object-oriented programming in R for Java programmers?
1 msg
Satoshi Takahama Object-oriented programming in R for Java programmers? Jul 27, 2008
Object-oriented programming in R for Java programmers?
3 msgs
Werner Wernersen Object-oriented programming in R for Java programmers? Jul 27, 2008
Johannes Hüsing Object-oriented programming in R for Java programmers? Jul 27, 2008
Jeroen Ooms Object-oriented programming in R for Java programmers? Jul 27, 2008
A easy way to write formula
3 msgs
ONKELINX, Thierry A easy way to write formula Jul 27, 2008
Mark Difford A easy way to write formula Jul 27, 2008
Hadley Wickham A easy way to write formula Jul 27, 2008
64-bit R on Mac OS X 10.5.4
1 msg
joseph 64-bit R on Mac OS X 10.5.4 Jul 27, 2008
Fitting a Bivariate Poisson log-normal distribution
1 msg
Famoye, Felix Fitting a Bivariate Poisson log-normal distribution Jul 27, 2008
melting a list: basic question
7 msgs
Baptiste Auguie melting a list: basic question Jul 25, 2008
Dieter Menne melting a list: basic question Jul 25, 2008
Baptiste Auguie melting a list: basic question Jul 25, 2008
Hadley Wickham melting a list: basic question Jul 25, 2008
Hadley Wickham melting a list: basic question Jul 25, 2008
Baptiste Auguie melting a list: basic question Jul 26, 2008
Hadley Wickham melting a list: basic question Jul 27, 2008
equivalent R functions for Numerical Recipes fitxy and fitexy ?
1 msg
Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 27, 2008
Spatial Sample
3 msgs
Raphael Saldanha Spatial Sample Jul 26, 2008
Paul Hiemstra Spatial Sample Jul 26, 2008
Roger Bivand Spatial Sample Jul 27, 2008
competing risk model with time dependent covariates under R or Splus
1 msg
BXC (Bendix Carstensen) competing risk model with time dependent covariates under R or Splus Jul 27, 2008
response surface analysis
1 msg
Jinsong Zhao response surface analysis Jul 27, 2008
re sponse surface analysis
1 msg
Tom La Bone re sponse surface analysis Jul 27, 2008
Weighted variance function?
2 msgs
Arun Kumar Saha Weighted variance function? Jul 27, 2008
Arun Kumar Saha Weighted variance function? Jul 27, 2008
GLS "no terms component" error
3 msgs
mm745 at st-andrews.ac.uk GLS "no terms component" error Jul 26, 2008
Bill Venables GLS "no terms component" error Jul 26, 2008
mm745 at st-andrews.ac.uk GLS "no terms component" error Jul 27, 2008
Retain plot?
2 msgs
rkevinburton at charter.net Retain plot? Jul 27, 2008
ONKELINX, Thierry Retain plot? Jul 27, 2008
Weighted variance function?
3 msgs
Arun Kumar Saha Weighted variance function? Jul 23, 2008
Gavin Simpson Weighted variance function? Jul 24, 2008
Arun Kumar Saha Weighted variance function? Jul 27, 2008
Color of box frame in Legend (Was: Matrix barplot)
1 msg
Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 27, 2008
A easy way to write formula
1 msg
Jinsong Zhao A easy way to write formula Jul 27, 2008
Complex to polar?
2 msgs
rkevinburton at charter.net Complex to polar? Jul 27, 2008
Brian Ripley Complex to polar? Jul 27, 2008
Marking Interval Length
9 msgs
Jia Ying Mei Marking Interval Length Jul 26, 2008
jim holtman Marking Interval Length Jul 26, 2008
Jia Ying Mei Marking Interval Length Jul 26, 2008
jim holtman Marking Interval Length Jul 26, 2008
Jia Ying Mei Analyzing Intervals between Data Jul 26, 2008
jim holtman Analyzing Intervals between Data Jul 26, 2008
Jia Ying Mei Analyzing Intervals between Data Jul 26, 2008
jim holtman Analyzing Intervals between Data Jul 26, 2008
jim holtman Analyzing Intervals between Data Jul 26, 2008
Data length mismatch.
7 msgs
rkevinburton at charter.net Data length mismatch. Jul 26, 2008
Gabor Grothendieck Data length mismatch. Jul 26, 2008
Gabor Grothendieck Data length mismatch. Jul 26, 2008
Gabor Grothendieck Data length mismatch. Jul 26, 2008
Gabor Grothendieck Data length mismatch. Jul 26, 2008
Gabor Grothendieck Data length mismatch. Jul 26, 2008
Don MacQueen Data length mismatch. Jul 26, 2008
Dividing by 0
1 msg
John Maindonald Dividing by 0 Jul 26, 2008
Sample
4 msgs
Raphael Saldanha Sample Jul 26, 2008
jim holtman Sample Jul 26, 2008
(Ted Harding) Sample Jul 26, 2008
Raphael Saldanha Sample Jul 26, 2008
Can't get the correct order from melt.data.frame of reshape library.
2 msgs
Daren Tan Can't get the correct order from melt.data.frame of reshape library. Jul 26, 2008
jim holtman Can't get the correct order from melt.data.frame of reshape library. Jul 26, 2008
issues with gap.plot function
2 msgs
Zheng Lu issues with gap.plot function Jul 26, 2008
Ben Bolker issues with gap.plot function Jul 26, 2008
Add a Vector to a Matrix
2 msgs
ascentnet Add a Vector to a Matrix Jul 26, 2008
Marc Schwartz Add a Vector to a Matrix Jul 26, 2008
Remove non-numerical columns from data frame
4 msgs
Markus Mühlbacher Remove non-numerical columns from data frame Jul 26, 2008
Henrique Dallazuanna Remove non-numerical columns from data frame Jul 26, 2008
Peter Dalgaard Remove non-numerical columns from data frame Jul 26, 2008
Henrik Bengtsson Remove non-numerical columns from data frame Jul 26, 2008
Beginning lm
4 msgs
rkevinburton at charter.net Beginning lm Jul 26, 2008
Mark Difford Beginning lm Jul 26, 2008
Marc Schwartz Beginning lm Jul 26, 2008
phguardiol at aol.com question about cmprsk library Jul 26, 2008
Thin frame line around R pdf output in LaTeX
3 msgs
Joseph Retzer Thin frame line around R pdf output in LaTeX Jul 25, 2008
Brian Ripley Thin frame line around R pdf output in LaTeX Jul 26, 2008
Joseph Retzer Thin frame line around R pdf output in LaTeX Jul 26, 2008
64-bit R on Mac OS X 10.4.5
3 msgs
joseph 64-bit R on Mac OS X 10.4.5 Jul 25, 2008
Steven McKinney 64-bit R on Mac OS X 10.4.5 Jul 25, 2008
Matthew Keller 64-bit R on Mac OS X 10.4.5 Jul 26, 2008
.Rprofile in RFrameworks?
1 msg
Fredrik Lundgren .Rprofile in RFrameworks? Jul 26, 2008
parametric bootstrap
1 msg
laila khalfan parametric bootstrap Jul 26, 2008
response surface analysis
2 msgs
Jinsong Zhao response surface analysis Jul 26, 2008
milton ruser response surface analysis Jul 26, 2008
how i can install Rgraphviz in R2.7.1
3 msgs
haani hanni how i can install Rgraphviz in R2.7.1 Jul 26, 2008
Duncan Murdoch how i can install Rgraphviz in R2.7.1 Jul 26, 2008
Martin Morgan how i can install Rgraphviz in R2.7.1 Jul 26, 2008
S-PLUS code in R
5 msgs
Fotis Papailias S-PLUS code in R Jul 26, 2008
Duncan Murdoch S-PLUS code in R Jul 26, 2008
Fotis Papailias S-PLUS code in R Jul 26, 2008
Fotis Papailias S-PLUS code in R Jul 26, 2008
Fotis Papailias S-PLUS code in R Jul 26, 2008
R-package install
7 msgs
cindy Guo R-package install Jul 24, 2008
Mark Difford R-package install Jul 24, 2008
cindy Guo R-package install Jul 24, 2008
Brian Ripley R-package install Jul 25, 2008
cindy Guo R-package install Jul 25, 2008
Brian Ripley R-package install Jul 26, 2008
Uwe Ligges R-package install Jul 26, 2008
competing risk model with time dependent covariates
1 msg
phguardiol at aol.com competing risk model with time dependent covariates Jul 26, 2008
Simple vector question.
4 msgs
rkevinburton at charter.net Simple vector question. Jul 25, 2008
jim holtman Simple vector question. Jul 25, 2008
rkevinburton at charter.net Simple vector question. Jul 25, 2008
jim holtman Simple vector question. Jul 26, 2008
Help to Text Windoes in Menu with TCL-TK
1 msg
ermimi Help to Text Windoes in Menu with TCL-TK Jul 26, 2008
gam() of package "mgcv" and anova()
1 msg
Kunio takezawa gam() of package "mgcv" and anova() Jul 26, 2008
Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd
5 msgs
David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008
Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008
David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008
Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008
David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 26, 2008
parametric bootstrap
2 msgs
laila khalfan parametric bootstrap Jul 25, 2008
Brian Ripley parametric bootstrap Jul 26, 2008
Write lower half of distance matrix only
6 msgs
pgseye Write lower half of distance matrix only Jul 25, 2008
jim holtman Write lower half of distance matrix only Jul 25, 2008
pgseye Write lower half of distance matrix only Jul 25, 2008
jim holtman Write lower half of distance matrix only Jul 25, 2008
pgseye Write lower half of distance matrix only Jul 25, 2008
Martin Maechler Write lower half of distance matrix only Jul 26, 2008
Matrix barplot
8 msgs
Andreas Tille Matrix barplot Jul 25, 2008
Nutter, Benjamin Matrix barplot Jul 25, 2008
Jim Lemon Matrix barplot Jul 25, 2008
Andreas Tille Matrix barplot Jul 25, 2008
ajay ohri Matrix barplot Jul 25, 2008
Andreas Tille Matrix barplot Jul 25, 2008
Andreas Tille Matrix barplot Jul 25, 2008
Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 26, 2008
error in test
2 msgs
Paul Adams error in test Jul 25, 2008
jim holtman error in test Jul 25, 2008
Help with matrix
2 msgs
Van Wyk, Jaap Help with matrix Jul 25, 2008
jim holtman Help with matrix Jul 25, 2008
Selecting the first measurement only from a longitudinal sequence
2 msgs
John James Selecting the first measurement only from a longitudinal sequence Jul 25, 2008
jim holtman Selecting the first measurement only from a longitudinal sequence Jul 25, 2008
Matrix from List
2 msgs
Nelson Villoria Matrix from List Jul 25, 2008
jim holtman Matrix from List Jul 25, 2008
Interactive plot using playwith() and abline
2 msgs
Christoph Scherber Interactive plot using playwith() and abline Jul 25, 2008
Felix Andrews Interactive plot using playwith() and abline Jul 25, 2008
parametric bootstrap
1 msg
laila khalfan parametric bootstrap Jul 25, 2008
Numerical question
4 msgs
Zhang Yanwei - Princeton-MRAm Numerical question Jul 25, 2008
stephen sefick Numerical question Jul 25, 2008
(Ted Harding) Numerical question Jul 25, 2008
Duncan Murdoch Numerical question Jul 25, 2008
How to pass function argument of same name to internal call?
2 msgs
Carl Witthoft How to pass function argument of same name to internal call? Jul 25, 2008
Duncan Murdoch How to pass function argument of same name to internal call? Jul 25, 2008
fit.dist gnlm question, NaN and Inf results
1 msg
Richard and Barbara Males fit.dist gnlm question, NaN and Inf results Jul 25, 2008
Installation error for RCurl in Redhat enterrpise 5
3 msgs
Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 Jul 24, 2008
Brian Ripley Installation error for RCurl in Redhat enterrpise 5 Jul 25, 2008
Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 Jul 25, 2008
Error in vector("double", length)
1 msg
Kumudan Error in vector("double", length) Jul 25, 2008
create multi windows plot at the same time
5 msgs
Alessandro create multi windows plot at the same time Jul 25, 2008
ctu at bigred.unl.edu create multi windows plot at the same time Jul 25, 2008
stephen sefick create multi windows plot at the same time Jul 25, 2008
Alessandro R: create multi windows plot at the same time Jul 25, 2008
ctu at bigred.unl.edu R: create multi windows plot at the same time Jul 25, 2008
plot zoo custom panel help
6 msgs
stephen sefick plot zoo custom panel help Jul 25, 2008
Gabor Grothendieck plot zoo custom panel help Jul 25, 2008
stephen sefick plot zoo custom panel help Jul 25, 2008
Gabor Grothendieck plot zoo custom panel help Jul 25, 2008
stephen sefick plot zoo custom panel help Jul 25, 2008
Gabor Grothendieck plot zoo custom panel help Jul 25, 2008
Bug in gap.plot
1 msg
Carl Witthoft Bug in gap.plot Jul 25, 2008
R-pmg (poor man gui) question
1 msg
Ferry R-pmg (poor man gui) question Jul 25, 2008
Pairs() function: selective changing of ylim; use of key
1 msg
David Afshartous Pairs() function: selective changing of ylim; use of key Jul 25, 2008
s-plus in R... simpler code
1 msg
Fotis Papailias s-plus in R... simpler code Jul 25, 2008
Dividing by 0
7 msgs
nmarti Dividing by 0 Jul 24, 2008
Robert Baer Dividing by 0 Jul 24, 2008
Rolf Turner Dividing by 0 Jul 24, 2008
Jim Lemon Dividing by 0 Jul 25, 2008
nmarti Dividing by 0 Jul 25, 2008
Roland Rau Dividing by 0 Jul 25, 2008
Patrick Burns Dividing by 0 Jul 25, 2008
transcript a matlab code in R
2 msgs
Fotis Papailias transcript a matlab code in R Jul 25, 2008
Berend Hasselman transcript a matlab code in R Jul 25, 2008
Rolling range and regression calculations
7 msgs
rcoder Rolling range and regression calculations Jul 24, 2008
Achim Zeileis Rolling range and regression calculations Jul 25, 2008
rcoder Rolling range and regression calculations Jul 25, 2008
stephen sefick Rolling range and regression calculations Jul 25, 2008
rcoder Rolling range and regression calculations Jul 25, 2008
stephen sefick Rolling range and regression calculations Jul 25, 2008
Gabor Grothendieck Rolling range and regression calculations Jul 25, 2008
need help in parametric bootstrap
1 msg
laila khalfan need help in parametric bootstrap Jul 25, 2008
Minor Bug in Documentation of merge()
2 msgs
Roland Rau Minor Bug in Documentation of merge() Jul 25, 2008
Duncan Murdoch Minor Bug in Documentation of merge() Jul 25, 2008
Tutorial on rgl Graphics
6 msgs
Tom La Bone Tutorial on rgl Graphics Jul 25, 2008
Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008
Tom La Bone Tutorial on rgl Graphics Jul 25, 2008
Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008
Tom La Bone Tutorial on rgl Graphics Jul 25, 2008
Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008
R2WinBUGS problem
5 msgs
Troels Ring R2WinBUGS problem Jul 24, 2008
paulandpen error with .dll file and RGtk2 Jul 24, 2008
Brian Ripley error with .dll file and RGtk2 Jul 24, 2008
Michael Lawrence error with .dll file and RGtk2 Jul 24, 2008
Uwe Ligges R2WinBUGS problem Jul 25, 2008
Maximization under constraits
1 msg
Ben Bolker Maximization under constraits Jul 25, 2008
extracting Pr>ltl from robcov/ols (Design)
3 msgs
ldb extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008
Mark Difford extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008
Frank E Harrell Jr extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008
S4 class and Package NAMESPACE [NC]
2 msgs
Sylvain ARCHENAULT S4 class and Package NAMESPACE [NC] Jul 25, 2008
Martin Morgan S4 class and Package NAMESPACE [NC] Jul 25, 2008
Fit a 3-Dimensional Line to Data Points
2 msgs
S. M. Niaz Arifin Fit a 3-Dimensional Line to Data Points Jul 24, 2008
Hans W Borchers Fit a 3-Dimensional Line to Data Points Jul 25, 2008
Integrating R and Textmate
4 msgs
Arthur Roberts Integrating R and Textmate Jul 24, 2008
Uwe Ligges Integrating R and Textmate Jul 25, 2008
Rob Goedman Integrating R and Textmate Jul 25, 2008
Hans-Jörg Bibiko Integrating R and Textmate Jul 25, 2008
Insert rows into a pre-existing data frame
2 msgs
naw3 at duke.edu Insert rows into a pre-existing data frame Jul 25, 2008
milton ruser Insert rows into a pre-existing data frame Jul 25, 2008
Saving a workspace with "extras"?
3 msgs
J.delasHeras at ed.ac.uk Saving a workspace with "extras"? Jul 25, 2008
Sarah Goslee Saving a workspace with "extras"? Jul 25, 2008
J.delasHeras at ed.ac.uk Saving a workspace with "extras"? Jul 25, 2008
Package np version 0.20-0 released to CRAN
1 msg
Jeffrey S. Racine Package np version 0.20-0 released to CRAN Jul 25, 2008
"Multiple" Regressions indexed by goodness of fit
1 msg
stephen sefick "Multiple" Regressions indexed by goodness of fit Jul 25, 2008
Plink bed files
2 msgs
Federico Calboli Plink bed files Jul 25, 2008
Robert Gentleman Plink bed files Jul 25, 2008
Scatterplot matrix one column vs. the rest of the dataset
2 msgs
stephen sefick Scatterplot matrix one column vs. the rest of the dataset Jul 25, 2008
stephen sefick Scatterplot matrix one column vs. the rest of the dataset Jul 25, 2008
Parallel Processing and Linear Regression
2 msgs
Alan Spearot Parallel Processing and Linear Regression Jul 24, 2008
Martin Morgan Parallel Processing and Linear Regression Jul 25, 2008
glht after lmer with "$S4class-" and "missing model.matrix-" errors
2 msgs
Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors Jul 25, 2008
Douglas Bates glht after lmer with "$S4class-" and "missing model.matrix-" errors Jul 25, 2008
Maximization under constraits
1 msg
Daniela Garavaglia Maximization under constraits Jul 25, 2008
pca
2 msgs
Alphonse Monkamg pca Jul 25, 2008
Zhang Yanwei - Princeton-MRAm pca Jul 25, 2008
Errror in running R2.7.1 version to R2.6.2 version
1 msg
Lazarus Mramba Errror in running R2.7.1 version to R2.6.2 version Jul 25, 2008
path and R CMD check
3 msgs
Christophe Genolini path and R CMD check Jul 23, 2008
Uwe Ligges path and R CMD check Jul 25, 2008
Christophe Genolini path and R CMD check Jul 25, 2008
Fit a 3-Dimensional Line to Data Points
2 msgs
Richard Cotton Fit a 3-Dimensional Line to Data Points Jul 25, 2008
Brian Ripley Fit a 3-Dimensional Line to Data Points Jul 25, 2008
Building a data frame with missing data
2 msgs
Natalia Quinteros Building a data frame with missing data Jul 25, 2008
Henrique Dallazuanna Building a data frame with missing data Jul 25, 2008
Relying on R to generate html tables with hyperlinks and pictures ?
2 msgs
Daren Tan Relying on R to generate html tables with hyperlinks and pictures ? Jul 24, 2008
Jim Lemon Relying on R to generate html tables with hyperlinks and pictures ? Jul 25, 2008
Bug in gap.plot
3 msgs
Arthur Roberts Bug in gap.plot Jul 24, 2008
Uwe Ligges Bug in gap.plot Jul 25, 2008
Jim Lemon Bug in gap.plot Jul 25, 2008
cannot allocate vector of size...
2 msgs
Uwe Ligges cannot allocate vector of size... Jul 25, 2008 silvia narduzzi cannot allocate vector of size... Jul 25, 2008
Formatting Syntax when Merging
2 msgs
Jia Ying Mei Formatting Syntax when Merging Jul 24, 2008
Gabor Grothendieck Formatting Syntax when Merging Jul 25, 2008
Three contrast matrices on the same linear model
1 msg
Christoph Scherber Three contrast matrices on the same linear model Jul 25, 2008
glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA
1 msg
Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA Jul 25, 2008
Help with rep
4 msgs
Van Wyk, Jaap Help with rep Jul 25, 2008
Peter Dalgaard Help with rep Jul 25, 2008
Gábor Csárdi Help with rep Jul 25, 2008
Dimitris Rizopoulos Help with rep Jul 25, 2008
discrete event simulation - "factory" with rework
1 msg
Sean O'Riordain discrete event simulation - "factory" with rework Jul 25, 2008
Error - unable to load shared library
2 msgs
Youngik Yang Error - unable to load shared library Jul 24, 2008
Brian Ripley Error - unable to load shared library Jul 25, 2008
problem in choosing cran mirror !
3 msgs
deepti nigam problem in choosing cran mirror ! Jul 24, 2008
Uwe Ligges problem in choosing cran mirror ! Jul 25, 2008
Brian Ripley problem in choosing cran mirror ! Jul 25, 2008
simple random number generation
4 msgs
dxc13 simple random number generation Jul 24, 2008
jim holtman simple random number generation Jul 24, 2008
Moshe Olshansky simple random number generation Jul 24, 2008
Rolf Turner simple random number generation Jul 24, 2008
simple random number generation
1 msg
S Ellison simple random number generation Jul 24, 2008
nlminb--lower bound for parameters are dependent on each others
1 msg
Kyeongmi Cheon nlminb--lower bound for parameters are dependent on each others Jul 24, 2008
How to....
6 msgs
Jia Ying Mei How to.... Jul 22, 2008
jim holtman How to.... Jul 22, 2008
Jim Lemon How to.... Jul 23, 2008
Jia Ying Mei How to.... Jul 23, 2008
Jia Ying Mei How to.... Jul 24, 2008
Jia Ying Mei How to.... Jul 24, 2008
How to preserve the numeric format and digits ?
3 msgs
Daren Tan How to preserve the numeric format and digits ? Jul 24, 2008
milton ruser How to preserve the numeric format and digits ? Jul 24, 2008
Austin, Matt How to preserve the numeric format and digits ? Jul 24, 2008
ggplot2 help
2 msgs
Edna Bell ggplot2 help Jul 24, 2008
David Freedman ggplot2 help Jul 24, 2008
Installing R packages in Textmate
2 msgs
Arthur Roberts Installing R packages in Textmate Jul 24, 2008
Don MacQueen Installing R packages in Textmate Jul 24, 2008
ANNOUNCE: rapache 1.1.0 release
1 msg
Jeffrey Horner ANNOUNCE: rapache 1.1.0 release Jul 24, 2008
OT: course in research administration
1 msg
Christopher W. Ryan OT: course in research administration Jul 24, 2008
still more dumb questions
2 msgs
Edna Bell still more dumb questions Jul 24, 2008
Rolf Turner still more dumb questions Jul 24, 2008
Interactive plot
5 msgs
Megh Dal Interactive plot Jul 24, 2008
Duncan Murdoch Interactive plot Jul 24, 2008
Megh Dal Interactive plot Jul 24, 2008
Duncan Murdoch Interactive plot Jul 24, 2008
David Scott Interactive plot Jul 24, 2008
NAs - NAs are not allowed in subscripted assignments
1 msg
Carl Witthoft NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
sem & testing multiple hypotheses with BIC
1 msg
John Fox sem & testing multiple hypotheses with BIC Jul 24, 2008
Should this PDF render correctly without font embedding?
4 msgs
Jeffrey Horner Should this PDF render correctly without font embedding? Jul 24, 2008
stephen sefick Should this PDF render correctly without font embedding? Jul 24, 2008
Rolf Turner Should this PDF render correctly without font embedding? Jul 24, 2008
(Ted Harding) Should this PDF render correctly without font embedding? Jul 24, 2008
Question: Beginner stuck in a R cycle
11 msgs
Daniela Ottaviani Question: Beginner stuck in a R cycle Jul 8, 2008
Greg Snow Question: Beginner stuck in a R cycle Jul 8, 2008
(Ted Harding) Question: Beginner stuck in a R cycle Jul 8, 2008
Rashid Nassar Question: Beginner stuck in a R cycle Jul 8, 2008
Jorge Ivan Velez Question: Beginner stuck in a R cycle Jul 8, 2008
Giovanni Petris Question: Beginner stuck in a R cycle Jul 8, 2008
Spencer Question: how to build a subset to do separate calculations Jul 24, 2008
Erik Iverson Question: how to build a subset to do separate calculations Jul 24, 2008
Erik Iverson Question: how to build a subset to do separate calculations Jul 24, 2008
stephen sefick Question: how to build a subset to do separate calculations Jul 24, 2008
stephen sefick Question: how to build a subset to do separate calculations Jul 24, 2008
Cairo graphics
2 msgs
Edna Bell Cairo graphics Jul 24, 2008
Philipp Pagel Cairo graphics Jul 24, 2008
SPR experiment: using lmer, transforming data, collinearity, and using a covariable
1 msg
Claire Delle Luche SPR experiment: using lmer, transforming data, collinearity, and using a covariable Jul 24, 2008
Subsetting an array by a vector of dimensions
8 msgs
Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008
Patrick Burns Subsetting an array by a vector of dimensions Jul 11, 2008
Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008
Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008
Wolfgang Huber Subsetting an array by a vector of dimensions Jul 11, 2008
Kenn Konstabel Subsetting an array by a vector of dimensions Jul 11, 2008
Wolfgang Huber Subsetting an array by a vector of dimensions Jul 11, 2008
Kenn Konstabel Subsetting an array by a vector of dimensions Jul 24, 2008
Coefficients of Logistic Regression from bootstrap - how to get them?
8 msgs
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Greg Snow Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Gad Abraham Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008
Bert Gunter Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008
John Kane Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008
factor question
3 msgs
Edna Bell factor question Jul 24, 2008
Henrique Dallazuanna factor question Jul 24, 2008
Mark Difford factor question Jul 24, 2008
NAs - NAs are not allowed in subscripted assignments
8 msgs
Richard Cotton NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
Coconut benchmark for R?
2 msgs
Imanpreet Coconut benchmark for R? Jul 24, 2008
Hans W Borchers Coconut benchmark for R? Jul 24, 2008
[Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
2 msgs
Michal Figurski [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 24, 2008
Frank E Harrell Jr [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 24, 2008
Problem with GLS dwtest function
1 msg
mm745 at st-andrews.ac.uk Problem with GLS dwtest function Jul 24, 2008
Calculating Betweenness - Efficiency problem
8 msgs
Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 18, 2008
jim holtman Calculating Betweenness - Efficiency problem Jul 19, 2008
Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 19, 2008
jim holtman Calculating Betweenness - Efficiency problem Jul 19, 2008
Gábor Csárdi Calculating Betweenness - Efficiency problem Jul 21, 2008
Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 22, 2008
Gábor Csárdi Calculating Betweenness - Efficiency problem Jul 23, 2008
Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 24, 2008
How to get rule number in arules
2 msgs
Daniel Wagner How to get rule number in arules Jul 24, 2008
Hans W Borchers How to get rule number in arules Jul 24, 2008
Help with which()
1 msg
Ben Bolker Help with which() Jul 24, 2008
Help with which()
5 msgs
naw3 at duke.edu Help with which() Jul 24, 2008
Erik Iverson Help with which() Jul 24, 2008
Ben Bolker Help with which() Jul 24, 2008
(Ted Harding) Help with which() Jul 24, 2008
Erik Iverson Help with which() Jul 24, 2008
What is wrong with this contrast matrix?
3 msgs
Christoph Scherber What is wrong with this contrast matrix? Jul 24, 2008
(Ted Harding) What is wrong with this contrast matrix? Jul 24, 2008
Christoph Scherber What is wrong with this contrast matrix? Jul 24, 2008
ggplot question
2 msgs
Williams Scott ggplot question Jul 24, 2008
Hadley Wickham ggplot question Jul 24, 2008
Problem with scatterplot3d example
3 msgs
Tom La Bone Problem with scatterplot3d example Jul 24, 2008
Duncan Murdoch Problem with scatterplot3d example Jul 24, 2008
Uwe Ligges Problem with scatterplot3d example Jul 24, 2008
How to delete duplicate cases?
6 msgs
Daniel Wagner How to delete duplicate cases? Jul 24, 2008
Jorge Ivan Velez How to delete duplicate cases? Jul 24, 2008
Henrique Dallazuanna How to delete duplicate cases? Jul 24, 2008
Erik Iverson How to delete duplicate cases? Jul 24, 2008
Marc Schwartz How to delete duplicate cases? Jul 24, 2008
Patrizio Frederic How to delete duplicate cases? Jul 24, 2008
incrementing for loop by 2
4 msgs
Clark, Jennifer H incrementing for loop by 2 Jul 24, 2008
Marc Schwartz incrementing for loop by 2 Jul 24, 2008
Wacek Kusnierczyk incrementing for loop by 2 Jul 24, 2008
Dimitris Rizopoulos incrementing for loop by 2 Jul 24, 2008
how know the status of particular process
2 msgs
Kurapati, Ravichandra (Ravichandra) how know the status of particular process Jul 24, 2008
Duncan Murdoch how know the status of particular process Jul 24, 2008
sum each row and output results
4 msgs
Rheannon sum each row and output results Jul 23, 2008
milton ruser sum each row and output results Jul 23, 2008
Henrique Dallazuanna sum each row and output results Jul 23, 2008
PIKAL Petr Odp: sum each row and output results Jul 24, 2008
Multinomial logistic regression with non-numerical data.
1 msg
TL Vincent Multinomial logistic regression with non-numerical data. Jul 24, 2008
Is there an equivalent * operator?
1 msg
René Capell Is there an equivalent * operator? Jul 24, 2008
Is there an equivalent * operator?
4 msgs
Williams, Robin Is there an equivalent * operator? Jul 24, 2008
Duncan Murdoch Is there an equivalent * operator? Jul 24, 2008
john seers (IFR) Is there an equivalent * operator? Jul 24, 2008
Felix Andrews Is there an equivalent * operator? Jul 24, 2008
Just 2 more questions - for now!
5 msgs
Williams, Robin Just 2 more questions - for now! Jul 24, 2008
stephen sefick Just 2 more questions - for now! Jul 24, 2008
Mark Difford Just 2 more questions - for now! Jul 24, 2008
Duncan Murdoch Just 2 more questions - for now! Jul 24, 2008
john seers (IFR) Just 2 more questions - for now! Jul 24, 2008
NAs - NAs are not allowed in subscripted assignments
1 msg
Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments Jul 24, 2008
convert a vector of words into a matrix
6 msgs
Daren Tan convert a vector of words into a matrix Jul 23, 2008
Patrick Burns convert a vector of words into a matrix Jul 24, 2008
Daren Tan convert a vector of words into a matrix Jul 24, 2008
Wacek Kusnierczyk convert a vector of words into a matrix Jul 24, 2008
Wacek Kusnierczyk convert a vector of words into a matrix Jul 24, 2008
Henrique Dallazuanna convert a vector of words into a matrix Jul 24, 2008
Problems with Rmpi and LAM 7.1.4
1 msg
giuseppe1.milicia at hsbcib.com Problems with Rmpi and LAM 7.1.4 Jul 24, 2008
Bootstraping GAMs: confidence intervals
1 msg
Luis Reino Bootstraping GAMs: confidence intervals Jul 24, 2008
unable to load a library
1 msg
Gérard Henry unable to load a library Jul 24, 2008
time zone - best way to shift hours
2 msgs
David Carslaw time zone - best way to shift hours Jul 24, 2008
Brian Ripley time zone - best way to shift hours Jul 24, 2008
Functions similar to step() and all.effects() that work for lme() objects?
2 msgs
Christoph Scherber Functions similar to step() and all.effects() that work for lme() objects? Jul 24, 2008
Brian Ripley Functions similar to step() and all.effects() that work for lme() objects? Jul 24, 2008
lmer model with continuos non normal response variable, transformation needed?
1 msg
Christoph Scherber lmer model with continuos non normal response variable, transformation needed? Jul 24, 2008
how can I write code to detect whether the machine is Windows or Linux?
5 msgs
Phil Smith how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008
Rolf Turner how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008
Marc Schwartz how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008
Gabor Grothendieck how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008
Peter Dalgaard how can I write code to detect whether the machine is Windows or Linux? Jul 24, 2008
truncated normal
2 msgs
Duncan Murdoch truncated normal Jul 23, 2008
Berwin A Turlach truncated normal Jul 23, 2008
Histogram
5 msgs
Angelo Scozzarella Histogram Jul 23, 2008
milton ruser Histogram Jul 23, 2008
Henrique Dallazuanna Histogram Jul 23, 2008
Mark Difford Histogram Jul 23, 2008
Vincent Goulet Histogram Jul 23, 2008
Can R fill in missing values?
3 msgs
Jia Ying Mei Can R fill in missing values? Jul 23, 2008
Erik Iverson Can R fill in missing values? Jul 23, 2008
Gabor Grothendieck Can R fill in missing values? Jul 23, 2008
Point-biserial correlation
3 msgs
Angelo Scozzarella Point-biserial correlation Jul 23, 2008
Tobias Verbeke Point-biserial correlation Jul 23, 2008
William Revelle Point-biserial correlation Jul 23, 2008
Aggregating zoo object with NAs in multiple column
2 msgs
Abiel Reinhart Aggregating zoo object with NAs in multiple column Jul 23, 2008
Achim Zeileis Aggregating zoo object with NAs in multiple column Jul 23, 2008
average replicate probe values
2 msgs
Kaposi-Novak, Pal average replicate probe values Jul 23, 2008
jim holtman average replicate probe values Jul 23, 2008
Constrained coefficients in lm (correction)
3 msgs
Jorge Ivan Velez Constrained coefficients in lm (correction) Jul 23, 2008
Horace Tso Constrained coefficients in lm (correction) Jul 23, 2008
Moshe Olshansky Constrained coefficients in lm (correction) Jul 23, 2008
an extremely simple question
3 msgs
Edna Bell an extremely simple question Jul 22, 2008
milton ruser an extremely simple question Jul 22, 2008
Michael Kubovy an extremely simple question Jul 23, 2008
Time series reliability questions
2 msgs
John Theal Time series reliability questions Jul 23, 2008
Achim Zeileis Time series reliability questions Jul 23, 2008
Coefficients of Logistic Regression from bootstrap - how to get them?
2 msgs
Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008
Simulating multilevel responses
1 msg
Elke Moons Simulating multilevel responses Jul 23, 2008
adding the mean and standard deviation to boxplots
4 msgs
Fernando Marmolejo Ramos adding the mean and standard deviation to boxplots Jul 22, 2008
jim holtman adding the mean and standard deviation to boxplots Jul 23, 2008
John Kane adding the mean and standard deviation to boxplots Jul 23, 2008
HBaize adding the mean and standard deviation to boxplots Jul 23, 2008
R2WinBUGS problem
1 msg
Troels Ring R2WinBUGS problem Jul 23, 2008
Flip Matrix form file?
3 msgs
Chris82 Flip Matrix form file? Jul 23, 2008
Henrik Bengtsson Flip Matrix form file? Jul 23, 2008
Chris82 Flip Matrix form file? Jul 23, 2008
truncated normal
3 msgs
cindy Guo truncated normal Jul 23, 2008
Duncan Murdoch truncated normal Jul 23, 2008
Duncan Murdoch truncated normal Jul 23, 2008
Q re iterating a process and appending results to output file
3 msgs
Eric C Banfield Q re iterating a process and appending results to output file Jul 23, 2008
jim holtman Q re iterating a process and appending results to output file Jul 23, 2008
Eric C Banfield Q re iterating a process and appending results to output file Jul 23, 2008
Histogram
1 msg
milton ruser Histogram Jul 23, 2008
Questions on weighted least squares
2 msgs
Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008
Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008
pvclust
1 msg
Eben Goodale pvclust Jul 23, 2008
Calling LISP programs in R
2 msgs
francogrex Calling LISP programs in R Jul 23, 2008
Steven McKinney Calling LISP programs in R Jul 23, 2008
Constrained coefficients in lm
1 msg
Jorge Ivan Velez Constrained coefficients in lm Jul 23, 2008
Sample on dataframe
4 msgs
Jarekj Sample on dataframe Jul 23, 2008
milton ruser Sample on dataframe Jul 23, 2008
Brian Ripley Sample on dataframe Jul 23, 2008
Jarekj Sample on dataframe Jul 23, 2008
Using if, else statements
1 msg
Gabriela Cendoya Using if, else statements Jul 23, 2008
Using if, else statements
7 msgs
Robin Williams Using if, else statements Jul 23, 2008
jim holtman Using if, else statements Jul 23, 2008
jim holtman Using if, else statements Jul 23, 2008
jim holtman Using if, else statements Jul 23, 2008
milton ruser Using if, else statements Jul 23, 2008
milton ruser Using if, else statements Jul 23, 2008
Gabriela Cendoya Using if, else statements Jul 23, 2008
Can't Load Text Files
4 msgs
Jia Ying Mei Can't Load Text Files Jul 22, 2008
milton ruser Can't Load Text Files Jul 22, 2008
Peter Alspach Can't Load Text Files Jul 22, 2008
Jia Ying Mei Can't Load Text Files Jul 23, 2008
Questions on weighted least squares
1 msg
Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008
Change font-face in title
8 msgs
Albin Blaschka Change font-face in title Jul 19, 2008
Gabor Grothendieck Change font-face in title Jul 19, 2008
jim holtman Change font-face in title Jul 19, 2008
Gabor Grothendieck Change font-face in title Jul 19, 2008
Albin Blaschka Change font-face in title Jul 19, 2008
Mike Prager Change font-face in title Jul 22, 2008
Gabor Grothendieck Change font-face in title Jul 22, 2008
Mike Prager Change font-face in title Jul 23, 2008
Warning message in if else statement
1 msg
Monica Pisica Warning message in if else statement Jul 23, 2008
Combining 4th column from 30 files
3 msgs
Daren Tan Combining 4th column from 30 files Jul 23, 2008
Henrique Dallazuanna Combining 4th column from 30 files Jul 23, 2008
Henrik Bengtsson Combining 4th column from 30 files Jul 23, 2008
Quantitative analysis of non-standard scatter plots.
5 msgs
Firas Swidan Quantitative analysis of non-standard scatter plots. Jul 23, 2008
Ben Bolker Quantitative analysis of non-standard scatter plots. Jul 23, 2008
Christofer Bogaso Quantitative analysis of non-standard scatter plots. Jul 23, 2008
Firas Swidan Quantitative analysis of non-standard scatter plots. Jul 23, 2008
Daniel Folkinshteyn Quantitative analysis of non-standard scatter plots. Jul 23, 2008
Warning message in if else statement
3 msgs
Monica Pisica Warning message in if else statement Jul 23, 2008
Erik Iverson Warning message in if else statement Jul 23, 2008
Monica Pisica Warning message in if else statement Jul 23, 2008
shQuote and cat
2 msgs
Vadim Ogranovich shQuote and cat Jul 23, 2008
Duncan Murdoch shQuote and cat Jul 23, 2008
Using if, else statements
1 msg
Patrick Burns Using if, else statements Jul 23, 2008
sequential sum of a vector...
8 msgs
Shubha Vishwanath Karanth sequential sum of a vector... Jul 23, 2008
Jorge Ivan Velez sequential sum of a vector... Jul 23, 2008
Patrizio Frederic sequential sum of a vector... Jul 23, 2008
William Revelle sequential sum of a vector... Jul 23, 2008
Gustaf Rydevik sequential sum of a vector... Jul 23, 2008
Marc Schwartz sequential sum of a vector... Jul 23, 2008
Henrique Dallazuanna sequential sum of a vector... Jul 23, 2008
denise xifaras sequential sum of a vector... Jul 23, 2008
Convert list of lists <--> data frame
9 msgs
Michael Friendly Convert list of lists <--> data frame Jul 23, 2008
Henrique Dallazuanna Convert list of lists <--> data frame Jul 23, 2008
Marc Schwartz Convert list of lists <--> data frame Jul 23, 2008
N. Lapidus Convert list of lists <--> data frame Jul 23, 2008
Patrizio Frederic Convert list of lists <--> data frame Jul 23, 2008
Ben Bolker Convert list of lists <--> data frame Jul 23, 2008
Jorge Ivan Velez Convert list of lists <--> data frame Jul 23, 2008
Marc Schwartz Convert list of lists <--> data frame Jul 23, 2008
Henrique Dallazuanna Convert list of lists <--> data frame Jul 23, 2008
sequential sum of a vector...
1 msg
Richard Cotton sequential sum of a vector... Jul 23, 2008
sequential sum of a vector...
1 msg
Shubha Vishwanath Karanth sequential sum of a vector... Jul 23, 2008
Using RODBC to use SQL queries
3 msgs
Albin Blaschka Using RODBC to use SQL queries Jul 23, 2008
Brian Ripley Using RODBC to use SQL queries Jul 23, 2008 Megan J Bellamy Using RODBC to use SQL queries Jul 23, 2008
Simple... but...
7 msgs
Shubha Vishwanath Karanth Simple... but... Jul 23, 2008
Doran, Harold Simple... but... Jul 23, 2008
Doran, Harold Simple... but... Jul 23, 2008
Gustaf Rydevik Simple... but... Jul 23, 2008
Ben Bolker Simple... but... Jul 23, 2008
Wacek Kusnierczyk Simple... but... Jul 23, 2008
Jorge Ivan Velez Simple... but... Jul 23, 2008
Simple... but...
17 msgs
Shubha Vishwanath Karanth Simple... but... Jul 23, 2008
Doran, Harold Simple... but... Jul 23, 2008
Henrique Dallazuanna Simple... but... Jul 23, 2008
Nutter, Benjamin Simple... but... Jul 23, 2008
Wacek Kusnierczyk Simple... but... Jul 23, 2008
ONKELINX, Thierry Simple... but... Jul 23, 2008
Jim Porzak Simple... but... Jul 23, 2008
Dimitris Rizopoulos Simple... but... Jul 23, 2008
(Ted Harding) Simple... but... Jul 23, 2008
Mitchell Maltenfort Simple... but... Jul 23, 2008
john seers (IFR) Simple... but... Jul 23, 2008
Wacek Kusnierczyk Simple... but... Jul 23, 2008
Berwin A Turlach Simple... but... Jul 23, 2008
Brian Ripley Simple... but... Jul 23, 2008
Gabor Grothendieck Simple... but... Jul 23, 2008
Leandro Marino RES: Simple... but... Jul 23, 2008
Wacek Kusnierczyk Simple... but... Jul 23, 2008
Plotting Multiple lines on one plot
3 msgs
R_Learner Plotting Multiple lines on one plot Jul 22, 2008
RichardP Plotting Multiple lines on one plot Jul 22, 2008
Hadley Wickham Plotting Multiple lines on one plot Jul 23, 2008
How to control the memory?
1 msg
rlearner309 How to control the memory? Jul 23, 2008
[Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?]
2 msgs
Michal Figurski [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 23, 2008
Gustaf Rydevik [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 23, 2008
Simple... but...
1 msg
Shubha Vishwanath Karanth Simple... but... Jul 23, 2008
Decoding subscripts/superscripts from CSVs
3 msgs
naw3 at duke.edu Decoding subscripts/superscripts from CSVs Jul 22, 2008
Mark Difford Decoding subscripts/superscripts from CSVs Jul 22, 2008
Jim Lemon Decoding subscripts/superscripts from CSVs Jul 23, 2008
par() function does not work
8 msgs
Fabio Sanchez par() function does not work Jul 23, 2008
Duncan Murdoch par() function does not work Jul 23, 2008
john seers (IFR) par() function does not work Jul 23, 2008
Peter Dalgaard par() function does not work Jul 23, 2008
Brian Ripley par() function does not work Jul 23, 2008
john seers (IFR) par() function does not work Jul 23, 2008
Henrique Dallazuanna par() function does not work Jul 23, 2008
Fabio Sanchez par() function does not work Jul 23, 2008
Editor for Mac
4 msgs
Angelo Scozzarella Editor for Mac Jul 22, 2008
Shige Song Editor for Mac Jul 22, 2008
Hans-Peter Suter Editor for Mac Jul 23, 2008
stephen sefick Editor for Mac Jul 23, 2008
R package
3 msgs
Sergi M.Garrido R package Jul 8, 2008
Duncan Murdoch R package Jul 8, 2008
Brian Ripley R package Jul 23, 2008
average replicate probe values
2 msgs
Kaposi-Novak, Pal average replicate probe values Jul 22, 2008
jim holtman average replicate probe values Jul 23, 2008
maximum likelihood method to fit a model
4 msgs
Brian Ripley maximum likelihood method to fit a model Jul 23, 2008 silvia narduzzi maximum likelihood method to fit a model Jul 23, 2008
Patrizio Frederic maximum likelihood method to fit a model Jul 23, 2008
Peter Dalgaard maximum likelihood method to fit a model Jul 23, 2008
How to simulate heteroscedasticity (correlation)
2 msgs
Jörg Groß How to simulate heteroscedasticity (correlation) Jul 22, 2008
Patrizio Frederic How to simulate heteroscedasticity (correlation) Jul 23, 2008
rpart confidence intervals?
2 msgs
RichardP rpart confidence intervals? Jul 22, 2008
Richard Pearson rpart confidence intervals? Jul 23, 2008
Indicator Kriging?
4 msgs
Sascha Bellaire Indicator Kriging? Jul 20, 2008
Alessandro experimental semivariogram Jul 21, 2008
ONKELINX, Thierry experimental semivariogram Jul 23, 2008
ONKELINX, Thierry Indicator Kriging? Jul 23, 2008
F test
2 msgs
Vicki Meng F test Jul 22, 2008
Peter Dalgaard F test Jul 23, 2008
scatter plot using ggplot
4 msgs
Megh Dal scatter plot using ggplot Jul 22, 2008
Hadley Wickham scatter plot using ggplot Jul 22, 2008
Megh Dal scatter plot using ggplot Jul 22, 2008
ONKELINX, Thierry scatter plot using ggplot Jul 23, 2008
mle2(): logarithm of negative pdfs
2 msgs
Zornitsa Luleva mle2(): logarithm of negative pdfs Jul 23, 2008
Patrizio Frederic mle2(): logarithm of negative pdfs Jul 23, 2008
Accessing individual variables from summary of lm
5 msgs
ascentnet Accessing individual variables from summary of lm Jul 21, 2008
Paul Smith Accessing individual variables from summary of lm Jul 22, 2008
ascentnet Accessing individual variables from summary of lm Jul 22, 2008
Mark Difford Accessing individual variables from summary of lm Jul 22, 2008
Mark Difford Accessing individual variables from summary of lm Jul 22, 2008
rpart node number
1 msg
Chua Siang Li rpart node number Jul 22, 2008
rpart$where and predict.rpart
1 msg
Chua Siang Li rpart$where and predict.rpart Jul 22, 2008
TextMate and R
2 msgs
Angelo Scozzarella TextMate and R Jul 22, 2008
Rob Goedman TextMate and R Jul 22, 2008
select significant variables
1 msg
闫梅 select significant variables Jul 22, 2008
deblur microscope image stacks
1 msg
Darren Weber deblur microscope image stacks Jul 22, 2008
F test
2 msgs
Vicki Meng F test Jul 22, 2008
Peter Dalgaard F test Jul 22, 2008
Erro: cannot allocate vector of size 216.0 Mb
9 msgs
José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 20, 2008
jim holtman Erro: cannot allocate vector of size 216.0 Mb Jul 20, 2008
Uwe Ligges Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008
Brian Ripley Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008
José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008
José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008
Rolf Turner Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008
José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008
Rolf Turner Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008
.asp (not really an R question) but related
2 msgs
stephen sefick .asp (not really an R question) but related Jul 22, 2008
Gabor Grothendieck .asp (not really an R question) but related Jul 22, 2008
help with simulate AR(1) data
4 msgs
cathelf help with simulate AR(1) data Jul 22, 2008
Rolf Turner help with simulate AR(1) data Jul 22, 2008
Peter Dalgaard help with simulate AR(1) data Jul 22, 2008
Rolf Turner help with simulate AR(1) data Jul 22, 2008
Cannot re-start R after bus error
1 msg
Ralph S. Cannot re-start R after bus error Jul 22, 2008
rollmean and stl
2 msgs
stephen sefick rollmean and stl Jul 22, 2008
Achim Zeileis rollmean and stl Jul 22, 2008
Cannot re-start R after bus error
2 msgs
Ralph S. Cannot re-start R after bus error Jul 22, 2008
Detlef Steuer Cannot re-start R after bus error Jul 22, 2008
How to filter a data frame?
8 msgs
rlearner309 How to filter a data frame? Jul 22, 2008
John Kane How to filter a data frame? Jul 22, 2008
Marc Schwartz How to filter a data frame? Jul 22, 2008
milton ruser How to filter a data frame? Jul 22, 2008
Peter Dalgaard How to filter a data frame? Jul 22, 2008
John Kane How to filter a data frame? Jul 22, 2008
Roland Rau How to filter a data frame? Jul 22, 2008
rlearner309 How to filter a data frame? Jul 22, 2008
Lattice: How to draw curves from given formulae
4 msgs
John Smith Lattice: How to draw curves from given formulae Jul 21, 2008
Deepayan Sarkar Lattice: How to draw curves from given formulae Jul 22, 2008
John Smith Lattice: How to draw curves from given formulae Jul 22, 2008
Deepayan Sarkar Lattice: How to draw curves from given formulae Jul 22, 2008
Reading the data from specific columns
2 msgs
Vidhu Choudhary Reading the data from specific columns Jul 22, 2008
Henrique Dallazuanna Reading the data from specific columns Jul 22, 2008
Function Error
1 msg
anna freni sterrantino Function Error Jul 22, 2008
Function Error
4 msgs
Angelo Scozzarella Function Error Jul 22, 2008
Erik Iverson Function Error Jul 22, 2008
Sarah Goslee Function Error Jul 22, 2008
Barry Rowlingson Function Error Jul 22, 2008
Help with rearranging data
4 msgs
William Pepe Help with rearranging data Jul 22, 2008
Henrik Bengtsson Help with rearranging data Jul 22, 2008
jim holtman Help with rearranging data Jul 22, 2008
William Pepe Help with rearranging data Jul 22, 2008
how to speed up this for loop?
6 msgs
Rheannon how to speed up this for loop? Jul 21, 2008
Bart Joosen how to speed up this for loop? Jul 22, 2008
PIKAL Petr Odp: how to speed up this for loop? Jul 22, 2008
Rheannon how to speed up this for loop? Jul 22, 2008
Nordlund, Dan (DSHS/RDA) how to speed up this for loop? Jul 22, 2008
Nordlund, Dan (DSHS/RDA) how to speed up this for loop? Jul 22, 2008
help on R benchmarks
1 msg
Jiangtian Li help on R benchmarks Jul 22, 2008
data transformation
2 msgs
Christian Hof data transformation Jul 22, 2008
Marc Schwartz data transformation Jul 22, 2008
randomForest Tutorial
3 msgs
Dirk Nemitz randomForest Tutorial Jul 22, 2008
Jim Porzak randomForest Tutorial Jul 22, 2008
Hans W Borchers randomForest Tutorial Jul 22, 2008
Does R have SQL interface in windows?
3 msgs
rlearner309 Does R have SQL interface in windows? Jul 22, 2008
Gabor Grothendieck Does R have SQL interface in windows? Jul 22, 2008
Brian Ripley Does R have SQL interface in windows? Jul 22, 2008
tklistbox and extracting selection to R
2 msgs
Judith Flores tklistbox and extracting selection to R Jul 22, 2008
Greg Snow tklistbox and extracting selection to R Jul 22, 2008
2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp
1 msg
sue at xlsolutions-corp.com 2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp Jul 22, 2008
drawing segments through points with pch=1
8 msgs
David Epstein drawing segments through points with pch=1 Jul 20, 2008
Paul Smith drawing segments through points with pch=1 Jul 20, 2008
Uwe Ligges drawing segments through points with pch=1 Jul 20, 2008
Brian Ripley drawing segments through points with pch=1 Jul 20, 2008
David Epstein drawing segments through points with pch=1 Jul 20, 2008
Jim Lemon drawing segments through points with pch=1 Jul 21, 2008
Martin Maechler drawing segments through points with pch=1 Jul 21, 2008
Mike Prager drawing segments through points with pch=1 Jul 22, 2008
normalised/transformed regressions
5 msgs
tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008
Greg Snow normalised/transformed regressions Jul 22, 2008
tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008
Greg Snow normalised/transformed regressions Jul 22, 2008
tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008
saving plot both as jpg and pdf
5 msgs
Monica Pisica saving plot both as jpg and pdf Jul 22, 2008
stephen sefick saving plot both as jpg and pdf Jul 22, 2008
Greg Snow saving plot both as jpg and pdf Jul 22, 2008
Monica Pisica saving plot both as jpg and pdf Jul 22, 2008
Tomas Lanczos saving plot both as jpg and pdf Jul 22, 2008
Error in installing packages
4 msgs
Lazarus Mramba Error in installing packages Jul 22, 2008
Richard Pearson Error in installing packages Jul 22, 2008
Ben Bolker Error in installing packages Jul 22, 2008
Gabor Grothendieck Error in installing packages Jul 22, 2008
Parameter names in nls
4 msgs
rhelp.20.trevva at spamgourmet.com Parameter names in nls Jul 21, 2008
Rolf Turner Parameter names in nls Jul 21, 2008
rhelp.20.trevva at spamgourmet.com Parameter names in nls Jul 22, 2008
Ben Bolker Parameter names in nls Jul 22, 2008
Large number of dummy variables
6 msgs
Alan Spearot Large number of dummy variables Jul 21, 2008
Doran, Harold Large number of dummy variables Jul 21, 2008
Bert Gunter Large number of dummy variables Jul 21, 2008
Douglas Bates Large number of dummy variables Jul 21, 2008
Doran, Harold Large number of dummy variables Jul 21, 2008
Martin Maechler Large number of dummy variables Jul 22, 2008
Opening files from R terminal - appologies
5 msgs
Williams, Robin Opening files from R terminal - appologies Jul 22, 2008
Gabor Grothendieck Opening files from R terminal - appologies Jul 22, 2008
Rossouw, Ruan (RF) Opening files from R terminal - appologies Jul 22, 2008
Sarah Goslee Opening files from R terminal - appologies Jul 22, 2008
Brian Ripley Opening files from R terminal - appologies Jul 22, 2008
Ignore previous emails
1 msg
Williams, Robin Ignore previous emails Jul 22, 2008
loop for multiple regressions
1 msg
Denise Xifara loop for multiple regressions Jul 22, 2008
alternate usage of soil.texture (plotrix)
2 msgs
Dylan Beaudette alternate usage of soil.texture (plotrix) Jul 21, 2008
Jim Lemon alternate usage of soil.texture (plotrix) Jul 22, 2008
y-axis number format on plot, barplot etc.
2 msgs
Bill Cunliffe y-axis number format on plot, barplot etc. Jul 21, 2008
Henrique Dallazuanna y-axis number format on plot, barplot etc. Jul 22, 2008
rpart$where and predict.rpart
2 msgs
Chua Siang Li rpart$where and predict.rpart Jul 22, 2008
Brian Ripley rpart$where and predict.rpart Jul 22, 2008
determing font type in expression
2 msgs
Thomas Hoffmann determing font type in expression Jul 22, 2008
Brian Ripley determing font type in expression Jul 22, 2008
xyplot help
2 msgs
ae2356 at hotmail.com xyplot help Jul 21, 2008
Felix Andrews xyplot help Jul 22, 2008
Table orderd by frequencies
3 msgs
Kunzler, Andreas Table orderd by frequencies Jul 22, 2008
Dimitris Rizopoulos Table orderd by frequencies Jul 22, 2008
Barry Rowlingson Table orderd by frequencies Jul 22, 2008
Reading SPSS .por files
1 msg
Jose Iparraguirre D'Elia Reading SPSS .por files Jul 22, 2008
Creation of png=problems
3 msgs
Romain Creation of png=problems Jul 21, 2008
Richard Pearson Creation of png=problems Jul 21, 2008
Brian Ripley Creation of png=problems Jul 22, 2008
Sum efficiently from large matrix according to re-occuring levels of factor?
7 msgs
Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
jim holtman Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008
Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 21, 2008
with lapply() how can you retrieve the name of the object
6 msgs
Andrew Yee with lapply() how can you retrieve the name of the object Jul 18, 2008
Jorge Ivan Velez with lapply() how can you retrieve the name of the object Jul 18, 2008
jim holtman with lapply() how can you retrieve the name of the object Jul 18, 2008
jim holtman with lapply() how can you retrieve the name of the object Jul 18, 2008
Jorge Ivan Velez with lapply() how can you retrieve the name of the object Jul 18, 2008
Andrew Yee with lapply() how can you retrieve the name of the object Jul 21, 2008
confusion matrix in randomForest
2 msgs
Miklos Kiss confusion matrix in randomForest Jul 19, 2008
Liaw, Andy confusion matrix in randomForest Jul 21, 2008
Conditionally Updating Lattice Plots
3 msgs
Bryan Hanson Conditionally Updating Lattice Plots Jul 20, 2008
Gabor Grothendieck Conditionally Updating Lattice Plots Jul 20, 2008
Deepayan Sarkar Conditionally Updating Lattice Plots Jul 21, 2008
Using integrate
2 msgs
Ayman Oweida Using integrate Jul 21, 2008
Duncan Murdoch Using integrate Jul 21, 2008
Large number of dummy variables
1 msg
Alan Spearot Large number of dummy variables Jul 21, 2008
name returned by lapply
2 msgs
Antje name returned by lapply Jul 18, 2008
Tony Plate name returned by lapply Jul 21, 2008
how to draw multiples curses (for given formulae) in lattice
1 msg
John Smith how to draw multiples curses (for given formulae) in lattice Jul 21, 2008
Control parameter of the optim( ): parscale
2 msgs
Zornitsa Luleva Control parameter of the optim( ): parscale Jul 21, 2008
Ben Bolker Control parameter of the optim( ): parscale Jul 21, 2008
Table of tables?
1 msg
Rolf Turner Table of tables? Jul 21, 2008
avoid loop with three-dimensional array
2 msgs
Michela Cameletti avoid loop with three-dimensional array Jul 21, 2008
Charles C. Berry avoid loop with three-dimensional array Jul 21, 2008
Howto Restart A Function with Try-Error Catch
2 msgs
Gundala Viswanath Howto Restart A Function with Try-Error Catch Jul 21, 2008
Patrick Connolly Howto Restart A Function with Try-Error Catch Jul 21, 2008
Editor fpr Mac OS
4 msgs
Angelo Scozzarella Editor fpr Mac OS Jul 21, 2008
Hans W Borchers Editor fpr Mac OS Jul 21, 2008
Don MacQueen Editor fpr Mac OS Jul 21, 2008
Rolf Turner Editor fpr Mac OS Jul 21, 2008
optimize function help!!
1 msg
emir.toktar at computer.org optimize function help!! Jul 21, 2008
vector help
4 msgs
Rajasekaramya vector help Jul 21, 2008
Jorge Ivan Velez vector help Jul 21, 2008
Henrique Dallazuanna vector help Jul 21, 2008
Dimitris Rizopoulos vector help Jul 21, 2008
Output Nicely formatted tables from R
4 msgs
Bill Cunliffe Output Nicely formatted tables from R Jul 21, 2008
Abhijit Dasgupta Output Nicely formatted tables from R Jul 21, 2008
Roberts, Kyle lattice with bwplot Jul 21, 2008
Henrique Dallazuanna lattice with bwplot Jul 21, 2008
Mclust - which cluster is each observation in?
2 msgs
cnagy Mclust - which cluster is each observation in? Jul 21, 2008
Julian Burgos Mclust - which cluster is each observation in? Jul 21, 2008
asp and ylim
12 msgs
David Epstein asp and ylim Jul 20, 2008
Rolf Turner asp and ylim Jul 20, 2008
David Epstein asp and ylim Jul 20, 2008
Gabor Grothendieck asp and ylim Jul 20, 2008
Brian Ripley asp and ylim Jul 20, 2008
Paul Smith asp and ylim Jul 20, 2008
David Epstein asp and ylim Jul 21, 2008
David Epstein asp and ylim Jul 21, 2008
Martin Maechler asp and ylim Jul 21, 2008
David Epstein asp and ylim Jul 21, 2008
Martin Maechler asp and ylim Jul 21, 2008
Greg Snow asp and ylim Jul 21, 2008
TeachingDemos question: my.symbols() alignment problems in complicated layout
5 msgs
maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 11, 2008
Paul Murrell TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 20, 2008
Hadley Wickham TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 20, 2008
maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 21, 2008
Greg Snow TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 21, 2008
portfolio optimization problem - use R
2 msgs
fzp2008 portfolio optimization problem - use R Jul 21, 2008
José Augusto Jr. portfolio optimization problem - use R Jul 21, 2008
dev2bitmap error, 'gs' cannot be found
2 msgs
Boel Brynedal dev2bitmap error, 'gs' cannot be found Jul 21, 2008
Brian Ripley dev2bitmap error, 'gs' cannot be found Jul 21, 2008
manipulate a matrix2
7 msgs
Jon Hak manipulate a matrix2 Jul 18, 2008
jim holtman manipulate a matrix2 Jul 18, 2008
Jon Hak manipulate a matrix2 Jul 21, 2008
jim holtman manipulate a matrix2 Jul 21, 2008
Jon Hak manipulate a matrix2 Jul 21, 2008
jim holtman manipulate a matrix2 Jul 21, 2008
Jon Hak manipulate a matrix2 Jul 21, 2008
Time Series - Long Memory Estimation
1 msg
Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008
On creating grouped data set.
2 msgs
Dong-hyun Oh On creating grouped data set. Jul 21, 2008
jim holtman On creating grouped data set. Jul 21, 2008
xyplot: distance between axis and axis-label gets wrong
1 msg
Sebastian Weber xyplot: distance between axis and axis-label gets wrong Jul 21, 2008
How to solve systems of nonlinear equations in R?
4 msgs
François Aucoin How to solve systems of nonlinear equations in R? Jul 18, 2008
Stuart Nettleton How to solve systems of nonlinear equations in R? Jul 18, 2008
Berend Hasselman How to solve systems of nonlinear equations in R? Jul 19, 2008
Ravi Varadhan How to solve systems of nonlinear equations in R? Jul 21, 2008
Avoid loop with three-dimensional array
1 msg
Michela Cameletti Avoid loop with three-dimensional array Jul 21, 2008
Subsetting data by date
8 msgs
Williams, Robin Subsetting data by date Jul 21, 2008
Gabor Grothendieck Subsetting data by date Jul 21, 2008
Gabor Grothendieck Subsetting data by date Jul 21, 2008
Williams, Robin Subsetting data by date Jul 21, 2008
Williams, Robin Subsetting data by date Jul 21, 2008
John Kane Subsetting data by date Jul 21, 2008
John Kane Subsetting data by date Jul 21, 2008
Gabor Grothendieck Subsetting data by date Jul 21, 2008
Cross correlation significance test
2 msgs
Nora Hanson Cross correlation significance test Jul 21, 2008
Nora Hanson Cross correlation significance test Jul 21, 2008
drawing segments through points with pch=1
1 msg
Paulo Barata drawing segments through points with pch=1 Jul 21, 2008
Getting plot axes where they should be!
5 msgs
(Ted Harding) Getting plot axes where they should be! Jul 21, 2008
Marc Schwartz Getting plot axes where they should be! Jul 21, 2008
Duncan Murdoch Getting plot axes where they should be! Jul 21, 2008
(Ted Harding) Getting plot axes where they should be! Jul 21, 2008
(Ted Harding) Getting plot axes where they should be! Jul 21, 2008
Time Series - Long Memory Estimation
2 msgs
Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008
Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008
par("din") vs dev.size()
2 msgs
Sarah Goslee par("din") vs dev.size() Jul 18, 2008
Brian Ripley par("din") vs dev.size() Jul 21, 2008
help with integrate function
1 msg
Brown, Andrew A help with integrate function Jul 21, 2008
CART and CHAID
2 msgs
Chua Siang Li CART and CHAID Jul 21, 2008
Achim Zeileis CART and CHAID Jul 21, 2008
fama-macbeth
1 msg
Denise Xifara fama-macbeth Jul 21, 2008
sampling from a list of values while excluding one
3 msgs
Juliane Struve sampling from a list of values while excluding one Jul 21, 2008
jim holtman sampling from a list of values while excluding one Jul 21, 2008
Juliane Struve sampling from a list of values while excluding one Jul 21, 2008
fama-macbeth
1 msg
Denise Xifara fama-macbeth Jul 21, 2008
A question on the quandratic programming
1 msg
Yunlei.Hu at barclayscapital.com A question on the quandratic programming Jul 21, 2008
CART Analysis
2 msgs
Darin Brooks CART Analysis Jul 21, 2008
Tobias Verbeke CART Analysis Jul 21, 2008
SVM: Graphical representation
1 msg
M Perez SVM: Graphical representation Jul 21, 2008
CART and CHAID
2 msgs
Chua Siang Li CART and CHAID Jul 20, 2008
Brian Ripley CART and CHAID Jul 21, 2008
RODBC - problems using odbcDriverConnect without DSN
2 msgs
Josiah Walker RODBC - problems using odbcDriverConnect without DSN Jul 20, 2008
Brian Ripley RODBC - problems using odbcDriverConnect without DSN Jul 21, 2008
Lattice Version of grconvertX or variant on panel.text?
4 msgs
Bryan Hanson Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008
Hadley Wickham Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008
Bryan Hanson Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008
Gabor Grothendieck Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008
smooth.spline
10 msgs
rkevinburton at charter.net smooth.spline Jul 17, 2008
Spencer Graves smooth.spline Jul 17, 2008
Roland Rau smooth.spline Jul 18, 2008
Spencer Graves smooth.spline Jul 18, 2008
rkevinburton at charter.net smooth.spline Jul 19, 2008
Hadley Wickham smooth.spline Jul 19, 2008
Spencer Graves smooth.spline Jul 20, 2008
Duncan Murdoch smooth.spline Jul 20, 2008
Spencer Graves smooth.spline Jul 20, 2008
rkevinburton at charter.net smooth.spline Jul 20, 2008
coin package (conditional inference / permutation): parameter teststat
1 msg
Paulo Barata coin package (conditional inference / permutation): parameter teststat Jul 20, 2008
enumerate subsets
4 msgs
lamack lamack enumerate subsets Jul 20, 2008
jim holtman enumerate subsets Jul 20, 2008
Peter Dalgaard enumerate subsets Jul 20, 2008
Gabor Grothendieck enumerate subsets Jul 20, 2008
Access to values of function arguments
5 msgs
willemf Access to values of function arguments Jul 20, 2008
Brian Ripley Access to values of function arguments Jul 20, 2008
Marc Schwartz Access to values of function arguments Jul 20, 2008
willemf Access to values of function arguments Jul 20, 2008
jim holtman Access to values of function arguments Jul 20, 2008
Non-linearly constrained optimisation
4 msgs
tolga.i.uzuner at jpmorgan.com Non-linearly constrained optimisation Jul 19, 2008
Stuart Nettleton Non-linearly constrained optimisation Jul 19, 2008
Gabor Grothendieck Non-linearly constrained optimisation Jul 19, 2008
Hans W Borchers Non-linearly constrained optimisation Jul 20, 2008
Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails)
1 msg
Mike Lawrence Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails) Jul 20, 2008
Erro updating HTML package descriptions in packages.html
5 msgs
José Augusto Jr. Erro updating HTML package descriptions in packages.html Jul 20, 2008
Uwe Ligges Erro updating HTML package descriptions in packages.html Jul 20, 2008
Gabor Grothendieck Erro updating HTML package descriptions in packages.html Jul 20, 2008
José Augusto Jr. Erro updating HTML package descriptions in packages.html Jul 20, 2008
Gabor Grothendieck Erro updating HTML package descriptions in packages.html Jul 20, 2008
Matching Up Values
1 msg
Steve Murray Matching Up Values Jul 20, 2008
fill in area between 2 lines with a color
3 msgs
David Freedman fill in area between 2 lines with a color Jul 20, 2008
Dimitris Rizopoulos fill in area between 2 lines with a color Jul 20, 2008
Marc Schwartz fill in area between 2 lines with a color Jul 20, 2008
principal factor analysis
2 msgs
Jinsong Zhao principal factor analysis Jul 19, 2008
Hans W Borchers principal factor analysis Jul 20, 2008
R interprets symbol as q()
3 msgs
Roger Leenders R interprets symbol as q() Jul 20, 2008
jim holtman R interprets symbol as q() Jul 20, 2008
Dieter Menne R interprets symbol as q() Jul 20, 2008
How do I install Joomla! 1.5?
1 msg
Fido How do I install Joomla! 1.5? Jul 20, 2008
Discretize continous variables....
12 msgs
milicic.marko Discretize continous variables.... Jul 19, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008
Daniel Malter Discretize continous variables.... Jul 19, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008
Daniel Malter Discretize continous variables.... Jul 19, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008
milicic.marko Discretize continous variables.... Jul 19, 2008
Johannes Hüsing Discretize continous variables.... Jul 19, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008
Johannes Hüsing Discretize continous variables.... Jul 20, 2008
Frank E Harrell Jr Discretize continous variables.... Jul 20, 2008
Error in edit(name,file,title,editor)
3 msgs
David Epstein Error in edit(name,file,title,editor) Jul 20, 2008
jim holtman Error in edit(name,file,title,editor) Jul 20, 2008
David Epstein Error in edit(name,file,title,editor) Jul 20, 2008
calculate differences - strange outcome
6 msgs
Kunzler, Andreas calculate differences - strange outcome Jul 17, 2008
PIKAL Petr Odp: calculate differences - strange outcome Jul 17, 2008
Berwin A Turlach calculate differences - strange outcome Jul 17, 2008
Mark Difford calculate differences - strange outcome Jul 17, 2008
Duncan Murdoch calculate differences - strange outcome Jul 17, 2008
Bernardo Rangel Tura calculate differences - strange outcome Jul 20, 2008
Order of columns(variables) in dataframe
4 msgs
Daniel Wagner Order of columns(variables) in dataframe Jul 20, 2008
jim holtman Order of columns(variables) in dataframe Jul 20, 2008
Dimitris Rizopoulos Order of columns(variables) in dataframe Jul 20, 2008
(Ted Harding) Order of columns(variables) in dataframe Jul 20, 2008
Parametric survival models with left truncated, right censored data
1 msg
Göran Broström Parametric survival models with left truncated, right censored data Jul 20, 2008
problem with read.table
2 msgs
carol white problem with read.table Jul 20, 2008
jim holtman problem with read.table Jul 20, 2008
estimating volume from xyz points
2 msgs
milton ruser estimating volume from xyz points Jul 19, 2008
Gabor Grothendieck estimating volume from xyz points Jul 20, 2008
problem with read.table
1 msg
carol white problem with read.table Jul 20, 2008
R version 2.7.1 (warnings)
2 msgs
Van Wyk, Jaap R version 2.7.1 (warnings) Jul 20, 2008
Mark Difford R version 2.7.1 (warnings) Jul 20, 2008
Sweave add code \201
3 msgs
Christophe Genolini Sweave add code \201 Jul 19, 2008
Peter Dalgaard Sweave add code \201 Jul 19, 2008
Christophe Genolini Sweave add code \201 Jul 20, 2008
replicate matrix blocks different numbers of times into new matrix
5 msgs
Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008
Peter Dalgaard replicate matrix blocks different numbers of times into new matrix Jul 19, 2008
Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008
jim holtman replicate matrix blocks different numbers of times into new matrix Jul 19, 2008
Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008
Likelihood ratio test between glm and glmer fits
5 msgs
Corey Sparks Likelihood ratio test between glm and glmer fits Jul 16, 2008
Dimitris Rizopoulos Likelihood ratio test between glm and glmer fits Jul 16, 2008
Rune Haubo Likelihood ratio test between glm and glmer fits Jul 17, 2008
Douglas Bates Likelihood ratio test between glm and glmer fits Jul 17, 2008
Göran Broström Likelihood ratio test between glm and glmer fits Jul 19, 2008
wroung groupedData despite reading Bates and Pinheiro 3 times
3 msgs
hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008
milton ruser wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008
hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008
Title for graph with multiple plots
4 msgs
Tolga Uzuner Title for graph with multiple plots Jul 19, 2008
jim holtman Title for graph with multiple plots Jul 19, 2008
(Ted Harding) Title for graph with multiple plots Jul 19, 2008
Tolga Uzuner Title for graph with multiple plots Jul 19, 2008
extracting colnames to label plots in a function
6 msgs
stephen sefick extracting colnames to label plots in a function Jul 19, 2008
Gabor Grothendieck extracting colnames to label plots in a function Jul 19, 2008
stephen sefick extracting colnames to label plots in a function Jul 19, 2008
stephen sefick extracting colnames to label plots in a function Jul 19, 2008
stephen sefick extracting colnames to label plots in a function Jul 19, 2008
Gabor Grothendieck extracting colnames to label plots in a function Jul 19, 2008
initialize a factor vector
6 msgs
Johannes Hüsing initialize a factor vector Jul 13, 2008
Gavin Simpson initialize a factor vector Jul 13, 2008
Johannes Hüsing initialize a factor vector Jul 13, 2008
Johannes Hüsing initialize a factor vector Jul 19, 2008
Patrick Burns initialize a factor vector Jul 19, 2008
Patrick Burns initialize a factor vector Jul 19, 2008
Resshufling algorithm (Thiago Souza)
2 msgs
Thiago Souza Resshufling algorithm (Thiago Souza) Jul 19, 2008
Bernardo Rangel Tura Resshufling algorithm (Thiago Souza) Jul 19, 2008
fixed effect significance with lmer() vs. t-test
1 msg
dej500 at york.ac.uk fixed effect significance with lmer() vs. t-test Jul 19, 2008
Graphics not working for R in ubuntu
4 msgs
Nataraj Graphics not working for R in ubuntu Jul 18, 2008
Mose Andre Graphics not working for R in ubuntu Jul 19, 2008
Michael Bibo Graphics not working for R in ubuntu Jul 19, 2008
Vincent Goulet Graphics not working for R in ubuntu Jul 19, 2008
system time - windows specific problem
3 msgs
Christophe Dutang system time - windows specific problem Jul 18, 2008
Duncan Murdoch system time - windows specific problem Jul 19, 2008
Christophe Dutang system time - windows specific problem Jul 19, 2008
t-test for multiple variables
4 msgs
Henning Wildhagen t-test for multiple variables Jul 18, 2008
Simon Anders t-test for multiple variables Jul 18, 2008
Henning Wildhagen t-test for multiple variables Jul 18, 2008
Simon Anders t-test for multiple variables Jul 19, 2008
"Spreading risk" in a matrix
4 msgs
ACroske "Spreading risk" in a matrix Jul 18, 2008
ONKELINX, Thierry "Spreading risk" in a matrix Jul 18, 2008
ACroske "Spreading risk" in a matrix Jul 18, 2008
ONKELINX, Thierry "Spreading risk" in a matrix Jul 19, 2008
R version 2.7.1 (warnings)
2 msgs
Van Wyk, Jaap R version 2.7.1 (warnings) Jul 19, 2008
Mark Difford R version 2.7.1 (warnings) Jul 19, 2008
problem with putting text in outer margins (mtext outer=TRUE)
2 msgs
Janet Young problem with putting text in outer margins (mtext outer=TRUE) Jul 18, 2008
jim holtman problem with putting text in outer margins (mtext outer=TRUE) Jul 18, 2008
Retrieving data from a tcl /tk function
1 msg
Judith Flores Retrieving data from a tcl /tk function Jul 18, 2008
spreading the risk
1 msg
Mark Leeds spreading the risk Jul 18, 2008
using which to identify a range of values
4 msgs
sj using which to identify a range of values Jul 18, 2008
Henrique Dallazuanna using which to identify a range of values Jul 18, 2008
Sébastien Bihorel using which to identify a range of values Jul 18, 2008
Julian Burgos using which to identify a range of values Jul 18, 2008
Functions similar to step() and all.effects() that work for lme() objects?
1 msg
Jon Zadra Functions similar to step() and all.effects() that work for lme() objects? Jul 18, 2008
How to cut data elements included in a text line
4 msgs
Christine A. How to cut data elements included in a text line Jul 18, 2008
Henrique Dallazuanna How to cut data elements included in a text line Jul 18, 2008
Jorge Ivan Velez How to cut data elements included in a text line Jul 18, 2008
Gabor Grothendieck How to cut data elements included in a text line Jul 18, 2008
histogram plot default
2 msgs
Xin Shi histogram plot default Jul 17, 2008
jim holtman histogram plot default Jul 18, 2008
copy number estimation through oligo package?
1 msg
Yupu Liang copy number estimation through oligo package? Jul 18, 2008
Polynomial Approximation with Exponential Kernel
1 msg
CJ Jackson Polynomial Approximation with Exponential Kernel Jul 18, 2008
Landscape mode for pdf
4 msgs
tolga.i.uzuner at jpmorgan.com Landscape mode for pdf Jul 18, 2008
Johannes Hüsing Landscape mode for pdf Jul 18, 2008
jim holtman Landscape mode for pdf Jul 18, 2008
tolga.i.uzuner at jpmorgan.com Landscape mode for pdf Jul 18, 2008
Reading SPSS .por files
3 msgs
Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008
Brian Ripley Reading SPSS .por files Jul 18, 2008
Peter Dalgaard Reading SPSS .por files Jul 18, 2008
REvolution computing
1 msg
Gregory R. Warnes REvolution computing Jul 18, 2008
re ad and check table
2 msgs
mysimbaa re ad and check table Jul 18, 2008
Henrique Dallazuanna re ad and check table Jul 18, 2008
cbind help
2 msgs
Rajasekaramya cbind help Jul 18, 2008
Henrique Dallazuanna cbind help Jul 18, 2008
REvolution computing
3 msgs
Gregory R. Warnes REvolution computing Jul 18, 2008
Uwe Ligges REvolution computing Jul 18, 2008
Charles Annis, P.E. REvolution computing Jul 18, 2008
dataedit
1 msg
Stephen Kennedy dataedit Jul 18, 2008
creating names for lists
3 msgs
tolga.i.uzuner at jpmorgan.com creating names for lists Jul 18, 2008
Henrique Dallazuanna creating names for lists Jul 18, 2008
tolga.i.uzuner at jpmorgan.com creating names for lists Jul 18, 2008
Reading SPSS .por files
2 msgs
Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008
Brian Ripley Reading SPSS .por files Jul 18, 2008
Problem with TLC/TK on Ubuntu
5 msgs
Davide Massidda Problem with TLC/TK on Ubuntu Jul 17, 2008
Dirk Eddelbuettel Problem with TLC/TK on Ubuntu Jul 17, 2008
Erik Iverson Problem with TLC/TK on Ubuntu Jul 17, 2008
Davide Massidda Problem with TLC/TK on Ubuntu Jul 17, 2008
Roland Rau Problem with TLC/TK on Ubuntu Jul 18, 2008
errors using step function
1 msg
silvia narduzzi errors using step function Jul 18, 2008
A neural network problem---neuralnet package
1 msg
Shubha Vishwanath Karanth A neural network problem---neuralnet package Jul 18, 2008
source code functions
3 msgs
stephen sefick source code functions Jul 18, 2008
Henrique Dallazuanna source code functions Jul 18, 2008
Gavin Simpson source code functions Jul 18, 2008
Reading SPSS .por files
2 msgs
Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008
Brian Ripley Reading SPSS .por files Jul 18, 2008
finding "chuncks" of data that have no NA s
5 msgs
stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008
Gabor Grothendieck finding "chuncks" of data that have no NA s Jul 18, 2008
stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008
Gabor Grothendieck finding "chuncks" of data that have no NA s Jul 18, 2008
stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008
only "T" becomes logical colum with read.table
2 msgs
Luis F only "T" becomes logical colum with read.table Jul 18, 2008
Henrique Dallazuanna only "T" becomes logical colum with read.table Jul 18, 2008
name returned by lapply
5 msgs
Antje name returned by lapply Jul 18, 2008
Gavin Simpson name returned by lapply Jul 18, 2008
Antje name returned by lapply Jul 18, 2008
Gavin Simpson name returned by lapply Jul 18, 2008
Antje name returned by lapply Jul 18, 2008
generate repeats of a vector's elements
3 msgs
Chaofeng Kou generate repeats of a vector's elements Jul 18, 2008
Antje generate repeats of a vector's elements Jul 18, 2008
Dimitris Rizopoulos generate repeats of a vector's elements Jul 18, 2008
Change font-face in title
1 msg
Albin Blaschka Change font-face in title Jul 18, 2008
probleme with R CMD check
3 msgs
Christophe Genolini probleme with R CMD check Jul 18, 2008
Martin Maechler probleme with R CMD check Jul 18, 2008
Christophe Genolini probleme with R CMD check Jul 18, 2008
Correction: RStat version 2.7.*1* now available
1 msg
Gregory R. Warnes Correction: RStat version 2.7.*1* now available Jul 18, 2008
Matching Up Values
1 msg
Steve Murray Matching Up Values Jul 18, 2008
RStat version 2.7.2 now available
1 msg
Gregory R. Warnes RStat version 2.7.2 now available Jul 18, 2008
matrix multiplication question
4 msgs
Murali K matrix multiplication question Jul 17, 2008
Duncan Murdoch matrix multiplication question Jul 17, 2008
Tsjerk Wassenaar matrix multiplication question Jul 17, 2008
Doran, Harold matrix multiplication question Jul 18, 2008
Equation sequencing
1 msg
Stuart Nettleton Equation sequencing Jul 18, 2008
function "eigen" AND Minitab
3 msgs
SH.Chou function "eigen" AND Minitab Jul 18, 2008
Bill Venables function "eigen" AND Minitab Jul 18, 2008
Patrick Burns function "eigen" AND Minitab Jul 18, 2008
column wise paste of data.frames
3 msgs
Sebastian Weber column wise paste of data.frames Jul 18, 2008
Dimitris Rizopoulos column wise paste of data.frames Jul 18, 2008
Patrick Burns column wise paste of data.frames Jul 18, 2008
Installation of garchOxFit
1 msg
Charlotte Falk Mogensen Installation of garchOxFit Jul 18, 2008
size and coding error in plot ?
4 msgs
shetumi at aim.com size and coding error in plot ? Jul 17, 2008
shetumi at aim.com size and coding error in plot ? Jul 17, 2008
Hadley Wickham size and coding error in plot ? Jul 17, 2008
Marc Schwartz size and coding error in plot ? Jul 17, 2008
Function to create variables with prefix
4 msgs
Moira Burke Function to create variables with prefix Jul 14, 2008
Uwe Ligges Function to create variables with prefix Jul 15, 2008
Moira Burke Function to create variables with prefix Jul 17, 2008
jim holtman Function to create variables with prefix Jul 17, 2008
Matching Up Values
4 msgs
Steve Murray Matching Up Values Jul 17, 2008
Peter Alspach Matching Up Values Jul 17, 2008
Rolf Turner Matching Up Values Jul 17, 2008
Hadley Wickham Matching Up Values Jul 17, 2008
How to convert/map jacktest results to dataframe or file
1 msg
Jason Lee How to convert/map jacktest results to dataframe or file Jul 17, 2008
combining lists of pairs
2 msgs
olvrmrs at aol.com combining lists of pairs Jul 17, 2008
Charles C. Berry combining lists of pairs Jul 17, 2008
REvolution computing
1 msg
David Henderson REvolution computing Jul 17, 2008
Newbie's question about lm
2 msgs
Ptit_Bleu Newbie's question about lm Jul 17, 2008
Mark Difford Newbie's question about lm Jul 17, 2008
Help with data layout - Thanks
1 msg
Iain Gallagher Help with data layout - Thanks Jul 17, 2008
nested calls, variable scope
1 msg
Jacob Wegelin nested calls, variable scope Jul 17, 2008
nested calls, variable scope
1 msg
Jacob Wegelin nested calls, variable scope Jul 17, 2008
Sampling distribution (PDF & CDF) of correlation
3 msgs
Michael Lawrence Sampling distribution (PDF & CDF) of correlation Jul 17, 2008
Maria Rizzo Sampling distribution (PDF & CDF) of correlation Jul 17, 2008
Charles C. Berry Sampling distribution (PDF & CDF) of correlation Jul 17, 2008
ubuntu and rgl package vs suse ?? static plots
3 msgs
H. Paul Benton ubuntu and rgl package vs suse ?? static plots Jul 17, 2008
Duncan Murdoch ubuntu and rgl package vs suse ?? static plots Jul 17, 2008
H. Paul Benton ubuntu and rgl package vs suse ?? static plots Jul 17, 2008
Display variables when running a script
4 msgs
naw3 at duke.edu Display variables when running a script Jul 17, 2008
jim holtman Display variables when running a script Jul 17, 2008
Stephan Kolassa Display variables when running a script Jul 17, 2008
Erik Iverson Display variables when running a script Jul 17, 2008
REvolution computing
2 msgs
Mariana Carla Gambarotta REvolution computing Jul 17, 2008
Marc Schwartz REvolution computing Jul 17, 2008
Comparing differences in AUC from 2 different models
2 msgs
Monica Pisica Comparing differences in AUC from 2 different models Jul 17, 2008
Frank E Harrell Jr Comparing differences in AUC from 2 different models Jul 17, 2008
Labelling curves on graphs
8 msgs
(Ted Harding) Labelling curves on graphs Jul 16, 2008
Austin, Matt Labelling curves on graphs Jul 16, 2008
(Ted Harding) Labelling curves on graphs Jul 16, 2008
Barry Rowlingson Labelling curves on graphs Jul 16, 2008
Frank E Harrell Jr Labelling curves on graphs Jul 16, 2008
Barry Rowlingson Labelling curves on graphs Jul 17, 2008
Frank E Harrell Jr Labelling curves on graphs Jul 17, 2008
(Ted Harding) Labelling curves on graphs Jul 17, 2008
Hiding information about functions in newly developed packages
4 msgs
Tudor Bodea Hiding information about functions in newly developed packages Jul 17, 2008
Peter Dalgaard Hiding information about functions in newly developed packages Jul 17, 2008
Bert Gunter Hiding information about functions in newly developed packages Jul 17, 2008
Marc Schwartz Hiding information about functions in newly developed packages Jul 17, 2008
help with data layout
5 msgs
Iain Gallagher help with data layout Jul 17, 2008
Erik Iverson help with data layout Jul 17, 2008
Henrique Dallazuanna help with data layout Jul 17, 2008
jim holtman help with data layout Jul 17, 2008
Michael Lawrence help with data layout Jul 17, 2008
negative P-values with shapiro.test
3 msgs
Mark Cowley negative P-values with shapiro.test Jul 15, 2008
Martin Maechler negative P-values with shapiro.test Jul 16, 2008
Martin Maechler negative P-values with shapiro.test Jul 17, 2008
help with data layout
1 msg
Satoshi Takahama help with data layout Jul 17, 2008
Can mvtnorm calculate a sequence of probabilities?
1 msg
di jianing Can mvtnorm calculate a sequence of probabilities? Jul 17, 2008
keeping seperate row.names
1 msg
Patrick Richardson keeping seperate row.names Jul 17, 2008
Colours in R
5 msgs
Leandro Marino Colours in R Jul 17, 2008
Duncan Murdoch Colours in R Jul 17, 2008
Leandro Marino RES: Colours in R Jul 17, 2008
PIKAL Petr Odp: Colours in R Jul 17, 2008
Earl F. Glynn Colours in R Jul 17, 2008
enscript states file for R scripts?
5 msgs
cmr.Pent at gmail.com enscript states file for R scripts? Jul 14, 2008
Hadley Wickham enscript states file for R scripts? Jul 15, 2008
cmr.Pent at gmail.com enscript states file for R scripts? Jul 15, 2008
Dirk Eddelbuettel enscript states file for R scripts? Jul 15, 2008
Peter Dalgaard enscript states file for R scripts? Jul 17, 2008
Histogram with two colors depending on condition
4 msgs
Ehsan Karim Histogram with two colors depending on condition Jul 17, 2008
jim holtman Histogram with two colors depending on condition Jul 17, 2008
Hadley Wickham Histogram with two colors depending on condition Jul 17, 2008
Greg Snow Histogram with two colors depending on condition Jul 17, 2008
Graph
2 msgs
Marco Chiapello Graph Jul 17, 2008
PIKAL Petr Odp: Graph Jul 17, 2008
Problem with mpi.close.Rslaves()
1 msg
Lyman, Mark Problem with mpi.close.Rslaves() Jul 17, 2008
errors using step function
1 msg
silvia narduzzi errors using step function Jul 17, 2008
Re : Re : float and double precision with C code
1 msg
Robert Re : Re : float and double precision with C code Jul 17, 2008
lm() question
2 msgs
Ranney, Steven lm() question Jul 2, 2008
Christoph Scherber lm() question Jul 17, 2008
Re : float and double precision with C code
1 msg
Robert Re : float and double precision with C code Jul 17, 2008
Problems with lm()
1 msg
Christoph Scherber Problems with lm() Jul 17, 2008
float and double precision with C code
2 msgs
Robert float and double precision with C code Jul 17, 2008
jim holtman float and double precision with C code Jul 17, 2008
spliting a string
1 msg
Wacek Kusnierczyk spliting a string Jul 17, 2008
how to split the string
1 msg
Kurapati, Ravichandra (Ravichandra) how to split the string Jul 17, 2008
spliting a string
2 msgs
Kurapati, Ravichandra (Ravichandra) spliting a string Jul 17, 2008
Jim Lemon spliting a string Jul 17, 2008
barchart with bars attached to y=0-line
5 msgs
Henning Wildhagen barchart with bars attached to y=0-line Jul 16, 2008
Gabor Grothendieck barchart with bars attached to y=0-line Jul 16, 2008
Deepayan Sarkar barchart with bars attached to y=0-line Jul 16, 2008
Henning Wildhagen barchart with bars attached to y=0-line Jul 17, 2008
Felix Andrews barchart with bars attached to y=0-line Jul 17, 2008
fastICA
1 msg
Mikhail Spivakov fastICA Jul 17, 2008
NAMESPACE vs internal.Rd
6 msgs
Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008
Berwin A Turlach NAMESPACE vs internal.Rd Jul 16, 2008
Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008
Berwin A Turlach NAMESPACE vs internal.Rd Jul 16, 2008
Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008
Berwin A Turlach NAMESPACE vs internal.Rd Jul 17, 2008
model.tables standard errors
1 msg
iwhite@staffmail.ed.ac.uk model.tables standard errors Jul 17, 2008
How to compute loglikelihood of Lognormal distribution
1 msg
Gundala Viswanath How to compute loglikelihood of Lognormal distribution Jul 17, 2008
help with bivariate density plot question
2 msgs
Daniela Carollo help with bivariate density plot question Jul 16, 2008
Mark Difford help with bivariate density plot question Jul 17, 2008
plot(linear model) without lines
2 msgs
Christopher W. Ryan plot(linear model) without lines Jul 16, 2008
Uwe Ligges plot(linear model) without lines Jul 17, 2008
how i can install Rgraphviz in R2.7.1
2 msgs
haani hanni how i can install Rgraphviz in R2.7.1 Jul 16, 2008
Uwe Ligges how i can install Rgraphviz in R2.7.1 Jul 17, 2008
shapiro wilk normality test
4 msgs
Bunny, lautloscrew.com shapiro wilk normality test Jul 12, 2008
Mark Leeds shapiro wilk normality test Jul 12, 2008
Greg Snow shapiro wilk normality test Jul 14, 2008
Emmanuel Charpentier shapiro wilk normality test Jul 17, 2008
Location of HTML help files
3 msgs
Jan Smit Location of HTML help files Jul 16, 2008
Henrik Bengtsson Location of HTML help files Jul 16, 2008
Jan Smit Location of HTML help files Jul 16, 2008
Help regarding arules package
2 msgs
Daniel Wagner Help regarding arules package Jul 16, 2008
jim holtman Help regarding arules package Jul 16, 2008
spectral decomposition for near-singular pd matrices
4 msgs
Prasenjit Kapat spectral decomposition for near-singular pd matrices Jul 16, 2008
Moshe Olshansky spectral decomposition for near-singular pd matrices Jul 16, 2008
Prasenjit Kapat spectral decomposition for near-singular pd matrices Jul 16, 2008
Moshe Olshansky spectral decomposition for near-singular pd matrices Jul 16, 2008
Stratified random sample
4 msgs
lamack lamack Stratified random sample Jul 16, 2008
Rolf Turner Stratified random sample Jul 16, 2008
Daniel Malter Stratified random sample Jul 16, 2008
Rolf Turner Stratified random sample Jul 16, 2008
How to extract component number of RMSEP in RMSEP plot
3 msgs
Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 15, 2008
Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 16, 2008
Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 16, 2008
create a function from a model
1 msg
jp d create a function from a model Jul 16, 2008
回复: cch() and coxph() for case-cohort
1 msg
Jin Wang 回复: cch() and coxph() for case-cohort Jul 16, 2008
R: gstat problem with lidar data
2 msgs
Dylan Beaudette R: gstat problem with lidar data Jul 16, 2008
Alessandro R: R: gstat problem with lidar data Jul 16, 2008
R logo
5 msgs
Christophe Genolini R logo Jul 15, 2008
Martin Maechler R logo Jul 16, 2008
Christophe Genolini R logo Jul 16, 2008
stefano iacus R logo Jul 16, 2008
Christophe Genolini R logo Jul 16, 2008
Function to verify existence of an R object
4 msgs
Judith Flores Function to verify existence of an R object Jul 16, 2008
Bert Gunter Function to verify existence of an R object Jul 16, 2008
Duncan Murdoch Function to verify existence of an R object Jul 16, 2008
Earl F. Glynn Function to verify existence of an R object Jul 16, 2008
RSQLite maximum table size
2 msgs
Vidhu Choudhary RSQLite maximum table size Jul 16, 2008
Gabor Grothendieck RSQLite maximum table size Jul 16, 2008
gstat problem with lidar data
2 msgs
Alessandro gstat problem with lidar data Jul 16, 2008
Dylan Beaudette gstat problem with lidar data Jul 16, 2008
Mapping data onto score
9 msgs
rcoder Mapping data onto score Jul 15, 2008
Ben Tupper Mapping data onto score Jul 15, 2008
rcoder Mapping data onto score Jul 15, 2008
Ben Tupper Mapping data onto score Jul 15, 2008
rcoder Mapping data onto score Jul 15, 2008
rcoder Mapping data onto score Jul 16, 2008
rcoder Mapping data onto score Jul 16, 2008
jim holtman Mapping data onto score Jul 16, 2008
Bert Gunter Mapping data onto score Jul 16, 2008
aov error with large data set
2 msgs
Michael Lawrence aov error with large data set Jul 15, 2008
Peter Dalgaard aov error with large data set Jul 16, 2008
date to decimal date conversion
2 msgs
Yogesh Tiwari date to decimal date conversion Jul 16, 2008
Gabor Grothendieck date to decimal date conversion Jul 16, 2008
Help with rpart.predict?
1 msg
L. Jay Roberts Help with rpart.predict? Jul 16, 2008
Confidence bands for model estimates using ns() spline basis
1 msg
Assaf oron Confidence bands for model estimates using ns() spline basis Jul 16, 2008
Problem with mpi.close.Rslaves()
1 msg
Lyman, Mark Problem with mpi.close.Rslaves() Jul 16, 2008
Output design question
2 msgs
Michael Kubovy Output design question Jul 16, 2008
Henrique Dallazuanna Output design question Jul 16, 2008
Forecasting enrollments with fuzzy time series
1 msg
Kate Forecasting enrollments with fuzzy time series Jul 16, 2008
extracting elements from print object of Manova()
3 msgs
Michael Rennie extracting elements from print object of Manova() Jul 15, 2008
Jorge Ivan Velez extracting elements from print object of Manova() Jul 15, 2008
Michael Friendly extracting elements from print object of Manova() Jul 16, 2008
randomForest outlier
1 msg
Birgit Lemcke randomForest outlier Jul 16, 2008
R-source code of a function
2 msgs
arezoo bagheri R-source code of a function Jul 16, 2008
Duncan Murdoch R-source code of a function Jul 16, 2008
randomForest outlier
3 msgs
Birgitle randomForest outlier Jul 15, 2008
Liaw, Andy randomForest outlier Jul 16, 2008
Birgit Lemcke randomForest outlier Jul 16, 2008
code reduction (if anyone feels like it)
6 msgs
stephen sefick code reduction (if anyone feels like it) Jul 15, 2008
jim holtman code reduction (if anyone feels like it) Jul 15, 2008
stephen sefick code reduction (if anyone feels like it) Jul 15, 2008
jim holtman code reduction (if anyone feels like it) Jul 15, 2008
jim holtman code reduction (if anyone feels like it) Jul 15, 2008
stephen sefick code reduction (if anyone feels like it) Jul 16, 2008
Font quality in base graphics
10 msgs
willemf Font quality in base graphics Jul 15, 2008
Jeffrey Horner Font quality in base graphics Jul 15, 2008
willemf Font quality in base graphics Jul 15, 2008
Mark Difford Font quality in base graphics Jul 15, 2008
Mike Prager Font quality in base graphics Jul 15, 2008
willemf Font quality in base graphics Jul 16, 2008
Mark Difford Font quality in base graphics Jul 16, 2008
Mark Difford Font quality in base graphics Jul 16, 2008
Gábor Csárdi Font quality in base graphics Jul 16, 2008
Gábor Csárdi Font quality in base graphics Jul 16, 2008
problem
1 msg
silvia narduzzi problem Jul 16, 2008
Group level frequencies
3 msgs
Kunzler, Andreas Group level frequencies Jul 16, 2008
Dimitris Rizopoulos Group level frequencies Jul 16, 2008
jim holtman Group level frequencies Jul 16, 2008
Howto view function's source code of an installed package
2 msgs
Gundala Viswanath Howto view function's source code of an installed package Jul 16, 2008
Paul Hiemstra Howto view function's source code of an installed package Jul 16, 2008
Regression problem
1 msg
Angila Albaros Regression problem Jul 16, 2008
eval.wih.vis
2 msgs
mysimbaa eval.wih.vis Jul 14, 2008
mysimbaa eval.wih.vis Jul 15, 2008
Problem installing R on openSUSE 10.3
4 msgs
A Ezhil Problem installing R on openSUSE 10.3 Jul 15, 2008
Detlef Steuer Problem installing R on openSUSE 10.3 Jul 15, 2008
A Ezhil Problem installing R on openSUSE 10.3 Jul 15, 2008
Detlef Steuer Problem installing R on openSUSE 10.3 Jul 15, 2008
Simulate data with binary outcome
1 msg
Steve Frost Simulate data with binary outcome Jul 15, 2008
Help Updating and Installing R Packages
2 msgs
Tariq Perwez Help Updating and Installing R Packages Jul 15, 2008
Vincent Goulet Help Updating and Installing R Packages Jul 15, 2008
Insurance review statistical methods
3 msgs
Kenneth Cabrera Insurance review statistical methods Jul 14, 2008
Yasir Kaheil Insurance review statistical methods Jul 15, 2008
Vincent Goulet Insurance review statistical methods Jul 15, 2008
Off-topic - Data needed
1 msg
Christofer Bogaso Off-topic - Data needed Jul 15, 2008
meaning of tests presented in anova(ols(...)) {Design package}
3 msgs
Dylan Beaudette meaning of tests presented in anova(ols(...)) {Design package} Jul 14, 2008
Mark Difford meaning of tests presented in anova(ols(...)) {Design package} Jul 15, 2008
Frank E Harrell Jr meaning of tests presented in anova(ols(...)) {Design package} Jul 15, 2008
New Zealand Maps
3 msgs
Tom Love New Zealand Maps Jul 15, 2008
Ray Brownrigg New Zealand Maps Jul 15, 2008
Ray Brownrigg New Zealand Maps Jul 15, 2008
Row Sum, exclude positive values
4 msgs
Rheannon Row Sum, exclude positive values Jul 15, 2008
Jorge Ivan Velez Row Sum, exclude positive values Jul 15, 2008
Jim Lemon Row Sum, exclude positive values Jul 15, 2008
Nordlund, Dan (DSHS/RDA) Row Sum, exclude positive values Jul 15, 2008
implementation of Prentice method in cch()
1 msg
Jin Wang implementation of Prentice method in cch() Jul 15, 2008
Mapping data onto 1-10 score
2 msgs
rcoder Mapping data onto 1-10 score Jul 15, 2008
Jim Lemon Mapping data onto 1-10 score Jul 15, 2008
playwith package crashes on Mac
7 msgs
Michael Kubovy playwith package crashes on Mac Jul 15, 2008
Leandro Marino Exporting an list() Jul 15, 2008
Henrique Dallazuanna Exporting an list() Jul 15, 2008
Jorge Ivan Velez Exporting an list() Jul 15, 2008
Felix Andrews playwith package crashes on Mac Jul 15, 2008
Michael Lawrence playwith package crashes on Mac Jul 15, 2008
Jim Lemon Exporting an list() Jul 15, 2008
Convert data set to data frame
3 msgs
Willa Wei Convert data set to data frame Jul 14, 2008
jim holtman Convert data set to data frame Jul 14, 2008
Jim Lemon Convert data set to data frame Jul 15, 2008
Off topic: Tcl/Tk outside R.
6 msgs
Rolf Turner Off topic: Tcl/Tk outside R. Jul 13, 2008
Peter Dalgaard Off topic: Tcl/Tk outside R. Jul 14, 2008
R P Herrold Off topic: Tcl/Tk outside R. Jul 14, 2008
Rolf Turner Off topic: Tcl/Tk outside R. Jul 14, 2008
Rolf Turner Off topic: Tcl/Tk outside R. Jul 14, 2008
Jim Lemon Off topic: Tcl/Tk outside R. Jul 15, 2008
Melt (reshape) question
4 msgs
Steve Murray Melt (reshape) question Jul 15, 2008
jim holtman Melt (reshape) question Jul 15, 2008
Hadley Wickham Melt (reshape) question Jul 15, 2008
Steve Murray Melt (reshape) question Jul 15, 2008
tryCatch - return from function to main script
2 msgs
Anne-Marie Ternes tryCatch - return from function to main script Jul 15, 2008
jim holtman tryCatch - return from function to main script Jul 15, 2008
What package to use to create a GUI
2 msgs
Judith Flores What package to use to create a GUI Jul 15, 2008
Bert Gunter What package to use to create a GUI Jul 15, 2008
Filtering output
2 msgs
rkevinburton at charter.net Filtering output Jul 15, 2008
jim holtman Filtering output Jul 15, 2008
Iterations
11 msgs
rkevinburton at charter.net Iterations Jul 15, 2008
Stephan Kolassa Iterations Jul 15, 2008
Jeff Newmiller Iterations Jul 15, 2008
Michael Rennie Iterations Jul 15, 2008
Michael Rennie Iterations Jul 15, 2008
Erik Iverson Iterations Jul 15, 2008
rkevinburton at charter.net Iterations Jul 15, 2008
rkevinburton at charter.net Iterations Jul 15, 2008
Erik Iverson Iterations Jul 15, 2008
Nordlund, Dan (DSHS/RDA) Iterations Jul 15, 2008
Rolf Turner Iterations Jul 15, 2008
sem & testing multiple hypotheses with BIC
1 msg
Donald Braman sem & testing multiple hypotheses with BIC Jul 15, 2008
POSIXct extract time
3 msgs
stephen sefick POSIXct extract time Jul 15, 2008
stephen sefick POSIXct extract time Jul 15, 2008
Henrique Dallazuanna POSIXct extract time Jul 15, 2008
generalized spatial autoregressive lag model
1 msg
De Tuimelaar generalized spatial autoregressive lag model Jul 15, 2008
matplot help
3 msgs
Michael Rennie matplot help Jul 10, 2008
Gabor Grothendieck matplot help Jul 10, 2008
Boyce, Morgan matplot help Jul 15, 2008
how to get confidential interval for classification accuracy using 10-fold validation in svm package
1 msg
larry88 how to get confidential interval for classification accuracy using 10-fold validation in svm package Jul 15, 2008
.First and .Rprofile won't run on startup
4 msgs
Susan Amrose .First and .Rprofile won't run on startup Jul 14, 2008
Rolf Turner .First and .Rprofile won't run on startup Jul 14, 2008
Bryan Hanson .First and .Rprofile won't run on startup Jul 14, 2008
Susan Amrose .First and .Rprofile won't run on startup Jul 15, 2008
INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R)
1 msg
INSEED statistics workshop INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R) Jul 15, 2008
INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R
1 msg
INSEED statistics workshop INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R Jul 15, 2008
Regression problem
4 msgs
Angila Albaros Regression problem Jul 15, 2008
Patrick Burns Regression problem Jul 15, 2008
Douglas Bates Regression problem Jul 15, 2008
Erik Iverson Regression problem Jul 15, 2008
Help with maptools sunriset()
1 msg
stephen sefick Help with maptools sunriset() Jul 15, 2008
sunrise sunset calculations
3 msgs
stephen sefick sunrise sunset calculations Jul 15, 2008
Chuck Cleland sunrise sunset calculations Jul 15, 2008
stephen sefick sunrise sunset calculations Jul 15, 2008
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
6 msgs
Daren Tan counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Ken Knoblauch counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Henrik Bengtsson counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Wolfgang Huber counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Patrick Aboyoun counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Riley, Steve counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008
Calculating Stream Metabolism
1 msg
stephen sefick Calculating Stream Metabolism Jul 15, 2008
manipulating (extracting) data from distance matrices
6 msgs
Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008
stephen sefick manipulating (extracting) data from distance matrices Jul 15, 2008
Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008
Jon Olav Skoien manipulating (extracting) data from distance matrices Jul 15, 2008
Sarah Goslee manipulating (extracting) data from distance matrices Jul 15, 2008
Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008
long data frame selection error
3 msgs
Rheannon long data frame selection error Jul 14, 2008
jim holtman long data frame selection error Jul 15, 2008
John Kane long data frame selection error Jul 15, 2008
DOE for logistic models
1 msg
Jeremy MAZET DOE for logistic models Jul 15, 2008
Random Forest %var(y)
2 msgs
David Katz Random Forest %var(y) Jul 5, 2008
Liaw, Andy Random Forest %var(y) Jul 15, 2008
creating axis of the plot before data are plotted -- solved
1 msg
Zroutik Zroutik creating axis of the plot before data are plotted -- solved Jul 15, 2008
Assoociative array?
23 msgs
rkevinburton at charter.net Assoociative array? Jul 12, 2008
jim holtman Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
Duncan Murdoch Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
jim holtman Assoociative array? Jul 12, 2008
Duncan Murdoch Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
Duncan Murdoch Assoociative array? Jul 12, 2008
jim holtman Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
rkevinburton at charter.net Assoociative array? Jul 12, 2008
jim holtman Assoociative array? Jul 13, 2008
rkevinburton at charter.net Assoociative array? Jul 13, 2008
jim holtman Assoociative array? Jul 13, 2008
rkevinburton at charter.net Assoociative array? Jul 14, 2008
jim holtman Assoociative array? Jul 14, 2008
rkevinburton at charter.net Assoociative array? Jul 14, 2008
jim holtman Assoociative array? Jul 15, 2008
rkevinburton at charter.net Assoociative array? Jul 15, 2008
rkevinburton at charter.net Assoociative array? Jul 15, 2008
rkevinburton at charter.net Assoociative array? Jul 15, 2008
Layers in graphs
2 msgs
René Capell Layers in graphs Jul 15, 2008
Thomas Fröjd Layers in graphs Jul 15, 2008
linear and non linear regression in 3D !
1 msg
Param Priya Singh linear and non linear regression in 3D ! Jul 15, 2008
Layers in graphs
1 msg
Thomas Fröjd Layers in graphs Jul 15, 2008
modeling binary response variables
6 msgs
Kevin J Emerson modeling binary response variables Jul 14, 2008
Daniel Malter modeling binary response variables Jul 14, 2008
Simon Blomberg modeling binary response variables Jul 14, 2008
Daniel Malter modeling binary response variables Jul 14, 2008
Simon Blomberg modeling binary response variables Jul 14, 2008
Daniel Malter modeling binary response variables Jul 15, 2008
Supressing printing from a function: ecdf
5 msgs
tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Jul 15, 2008
Patrick Burns Supressing printing from a function: ecdf Jul 15, 2008
Brian Ripley Supressing printing from a function: ecdf Jul 15, 2008
Ivar Herfindal Supressing printing from a function: ecdf Jul 15, 2008
tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Jul 15, 2008
Odd behavior of remove command
1 msg
Dennis Fisher Odd behavior of remove command Jul 15, 2008
Proxy again, this time on a Mac
2 msgs
LostInTimeAndSpace Proxy again, this time on a Mac Jul 15, 2008
Brian Ripley Proxy again, this time on a Mac Jul 15, 2008
position of a specific character
4 msgs
Hua Li position of a specific character Jul 14, 2008
Erik Iverson position of a specific character Jul 14, 2008
Hua Li position of a specific character Jul 14, 2008
Brian Ripley position of a specific character Jul 15, 2008
[Ask]Robust Buckley-James like estimator
1 msg
abdul kudus Robust Buckley-James like estimator Jul 14, 2008
r^2 for SSasymp?
1 msg
Robert Terwilliger r^2 for SSasymp? Jul 14, 2008
question about a small "for" loop
4 msgs
Wolfgang Huber question about a small "for" loop Jul 14, 2008
milton ruser question about a small "for" loop Jul 14, 2008 Christopher W. Ryan question about a small "for" loop Jul 14, 2008
Christopher W. Ryan question about a small "for" loop Jul 14, 2008
Data Manipulations and SQL
2 msgs
Willa Wei Data Manipulations and SQL Jul 14, 2008
Gabor Grothendieck Data Manipulations and SQL Jul 14, 2008
creating axis of the plot before data are plotted
4 msgs
Zroutik Zroutik creating axis of the plot before data are plotted Jul 14, 2008
stephen sefick creating axis of the plot before data are plotted Jul 14, 2008
Zroutik Zroutik creating axis of the plot before data are plotted Jul 14, 2008
stephen sefick creating axis of the plot before data are plotted Jul 14, 2008
[Fwd: Re: Insurance review statistical methods]
1 msg
Kenneth Cabrera [Fwd: Re: Insurance review statistical methods] Jul 14, 2008
rgl.snapshot on linux produces colored lines only
1 msg
Matt rgl.snapshot on linux produces colored lines only Jul 14, 2008
Extract and plot array from data
1 msg
theBenjamin Extract and plot array from data Jul 14, 2008
statistics question about a statement in julian faraway's "extending the linear model with R" text
4 msgs
Mark Leeds statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008
Greg Snow statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008
Duncan Murdoch statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008
Peter Dalgaard statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008
R Commander question
3 msgs
Darin Brooks R Commander question Jul 14, 2008
John Kane R Commander question Jul 14, 2008
Darin Brooks R Commander question Jul 14, 2008
Analysis of poorly replicated array data
2 msgs
Eli Meyer Analysis of poorly replicated array data Jul 14, 2008
Wolfgang Huber Analysis of poorly replicated array data Jul 14, 2008
Tissue specific genes by ANOVA?
4 msgs
icebreake Tissue specific genes by ANOVA? Jul 14, 2008
Marcelo Laia Tissue specific genes by ANOVA? Jul 14, 2008
icebreake Tissue specific genes by ANOVA? Jul 14, 2008
Marcelo Laia Tissue specific genes by ANOVA? Jul 14, 2008
any way to set defaults for par?
3 msgs
Carl Witthoft any way to set defaults for par? Jul 13, 2008
jim holtman any way to set defaults for par? Jul 13, 2008
Greg Snow any way to set defaults for par? Jul 14, 2008
Difficultes with grep
6 msgs
Fran100681 Difficultes with grep Jul 11, 2008
jim holtman Difficultes with grep Jul 11, 2008
Fran100681 Difficultes with grep Jul 13, 2008
Charles C. Berry Difficultes with grep Jul 13, 2008
jim holtman Difficultes with grep Jul 13, 2008
Fran100681 Difficultes with grep Jul 14, 2008
Sweave, backslash in sub pattern? was: Backslash in sub pattern?
4 msgs
Stephan Kolassa Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008
Duncan Murdoch Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008
Stephan Kolassa Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008
Marc Schwartz Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008
dll problem
2 msgs
Stephen Bond dll problem Jul 14, 2008
Brian Ripley dll problem Jul 14, 2008
Backslash in sub pattern?
2 msgs
Stephan Kolassa Backslash in sub pattern? Jul 14, 2008
Marc Schwartz Backslash in sub pattern? Jul 14, 2008
A question about using function plot
6 msgs
Jason Liao A question about using function plot Jul 14, 2008
Sarah Goslee A question about using function plot Jul 14, 2008
Henrique Dallazuanna A question about using function plot Jul 14, 2008
Chuck Cleland A question about using function plot Jul 14, 2008
Robert Baer A question about using function plot Jul 14, 2008
Richard M. Heiberger A question about using function plot Jul 14, 2008
applying complex functions by groups
2 msgs
Finch, W. Holmes applying complex functions by groups Jul 14, 2008
jim holtman applying complex functions by groups Jul 14, 2008
More compact form of lm object that can be used for prediction?
6 msgs
Woolner, Keith More compact form of lm object that can be used for prediction? Jul 11, 2008
Marc Schwartz More compact form of lm object that can be used for prediction? Jul 11, 2008
Woolner, Keith More compact form of lm object that can be used for prediction? Jul 11, 2008
Marc Schwartz More compact form of lm object that can be used for prediction? Jul 11, 2008
Charles C. Berry More compact form of lm object that can be used for prediction? Jul 11, 2008
Woolner, Keith More compact form of lm object that can be used for prediction? Jul 14, 2008
Strptime/ date time classes
2 msgs
Caroline Keef Strptime/ date time classes Jul 14, 2008
Mark Difford Strptime/ date time classes Jul 14, 2008
Help with an error message
2 msgs
naw3 at duke.edu Help with an error message Jul 14, 2008
stephen sefick Help with an error message Jul 14, 2008
.Last() and namespace
1 msg
Ralf Tautenhahn .Last() and namespace Jul 14, 2008
macros in R
2 msgs
Erin Hodgess macros in R Jul 14, 2008
Chuck Cleland macros in R Jul 14, 2008
swap_tail macro in pnorm.c
1 msg
Adam B. Thompson swap_tail macro in pnorm.c Jul 14, 2008
ampersand char in the path causing error message when running rscript.bat
1 msg
Zroutik Zroutik ampersand char in the path causing error message when running rscript.bat Jul 14, 2008
Can't compile in HPUX 11.31 on IA64
1 msg
Jackson,Daniel Can't compile in HPUX 11.31 on IA64 Jul 14, 2008
aggregate months to years
3 msgs
Oehler, Friderike (AGPP) aggregate months to years Jul 14, 2008
Henrique Dallazuanna aggregate months to years Jul 14, 2008
PIKAL Petr Odp: aggregate months to years Jul 14, 2008
How to load stats4 package
2 msgs
Surendra champanerkar How to load stats4 package Jul 14, 2008
Duncan Murdoch How to load stats4 package Jul 14, 2008
Loop problem
4 msgs
fernanda lopez Loop problem Jul 14, 2008
Dimitris Rizopoulos Loop problem Jul 14, 2008
Daniel Malter Loop problem Jul 14, 2008
Gabor Grothendieck Loop problem Jul 14, 2008
how to correlate nominal variables?
2 msgs
Timo Stolz how to correlate nominal variables? Jul 14, 2008
Daniel Malter how to correlate nominal variables? Jul 14, 2008
options() question for displaying numbers in the GUI
3 msgs
tolga.i.uzuner at jpmorgan.com options() question for displaying numbers in the GUI Jul 14, 2008
Henrique Dallazuanna options() question for displaying numbers in the GUI Jul 14, 2008
tolga.i.uzuner at jpmorgan.com options() question for displaying numbers in the GUI Jul 14, 2008
How to extract folowing data?
2 msgs
Megh Dal How to extract folowing data? Jul 14, 2008
Ben Tupper How to extract folowing data? Jul 14, 2008
"Reasonable doubt" - was "Re: shapiro wilk normality test"
1 msg
S Ellison "Reasonable doubt" - was "Re: shapiro wilk normality test" Jul 14, 2008
Frequency-Table on Group Level - Multi Level Analysis
1 msg
Kunzler, Andreas Frequency-Table on Group Level - Multi Level Analysis Jul 14, 2008
nlme, lme( ) convergence and selection of effects
1 msg
Thiago Cortez Costa nlme, lme( ) convergence and selection of effects Jul 14, 2008
rm(l*)
3 msgs
Oehler, Friderike (AGPP) rm(l*) Jul 14, 2008
Gábor Csárdi rm(l*) Jul 14, 2008
Brian Ripley rm(l*) Jul 14, 2008
Installing RWinEdt
4 msgs
rkevinburton at charter.net Installing RWinEdt Jul 12, 2008
Uwe Ligges Installing RWinEdt Jul 13, 2008
rkevinburton at charter.net Installing RWinEdt Jul 13, 2008
Uwe Ligges Installing RWinEdt Jul 14, 2008
Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable
1 msg
eugen pircalabelu Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable Jul 14, 2008
false discovery rate !
1 msg
john seers (IFR) false discovery rate ! Jul 14, 2008
source code for R-dev packages
2 msgs
Mark Kimpel source code for R-dev packages Jul 13, 2008
Brian Ripley source code for R-dev packages Jul 14, 2008
Using Internals via their compiled sources
1 msg
rnoob Using Internals via their compiled sources Jul 13, 2008
Computing row means for sets of 2 columns
3 msgs
Daren Tan Computing row means for sets of 2 columns Jul 13, 2008
Henrik Bengtsson Computing row means for sets of 2 columns Jul 13, 2008
Daren Tan Computing row means for sets of 2 columns Jul 13, 2008
stem and leaf plot: how to edit the stem-values
3 msgs
Jörg Groß stem and leaf plot: how to edit the stem-values Jul 13, 2008
Duncan Murdoch stem and leaf plot: how to edit the stem-values Jul 13, 2008
Rolf Turner stem and leaf plot: how to edit the stem-values Jul 13, 2008
Reading Multi-value data fields for descriptive analysis
6 msgs
Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 12, 2008
jim holtman Reading Multi-value data fields for descriptive analysis Jul 12, 2008
Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 12, 2008
jim holtman Reading Multi-value data fields for descriptive analysis Jul 13, 2008
Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 13, 2008
jim holtman Reading Multi-value data fields for descriptive analysis Jul 13, 2008
Moran's I- Ordinal Logistic Regression
1 msg
Lisa Rees Moran's I- Ordinal Logistic Regression Jul 13, 2008
Moran's I test- Ordinal Logistic Regression Model
1 msg
Rees, Lisa Marie (MU-Student) Moran's I test- Ordinal Logistic Regression Model Jul 13, 2008
shapiro wilk normality test
11 msgs
Marta Colombo shapiro wilk normality test Jul 13, 2008
Frank E Harrell Jr shapiro wilk normality test Jul 13, 2008
(Ted Harding) shapiro wilk normality test Jul 13, 2008
Charles Annis, P.E. shapiro wilk normality test Jul 13, 2008
Berwin A Turlach shapiro wilk normality test Jul 13, 2008
(Ted Harding) shapiro wilk normality test Jul 13, 2008
Frank E Harrell Jr shapiro wilk normality test Jul 13, 2008
Johannes Hüsing shapiro wilk normality test Jul 13, 2008
(Ted Harding) shapiro wilk normality test Jul 13, 2008
Johannes Hüsing shapiro wilk normality test Jul 13, 2008
(Ted Harding) shapiro wilk normality test Jul 13, 2008
(no subject)
2 msgs
Paul Adams (no subject) Jul 13, 2008
jim holtman (no subject) Jul 13, 2008
how do I read only specific columns using read.csv or other read function
5 msgs
Phil Smith how do I read only specific columns using read.csv or other read function Jul 2, 2008
Ben Tupper how do I read only specific columns using read.csv or other read function Jul 2, 2008
Charles C. Berry how do I read only specific columns using read.csv or other read function Jul 2, 2008
Juliet Hannah how do I read only specific columns using read.csv or other read function Jul 13, 2008
Charles C. Berry how do I read only specific columns using read.csv or other read function Jul 13, 2008
Quick plotmath question
5 msgs
Michael Lawrence Quick plotmath question Jul 12, 2008
Christian Ritz Quick plotmath question Jul 12, 2008
Gabor Grothendieck Quick plotmath question Jul 12, 2008
Gabor Grothendieck Quick plotmath question Jul 12, 2008
Michael Lawrence Quick plotmath question Jul 13, 2008
rm anova
1 msg
korhan ozkan rm anova Jul 13, 2008
Excel Trend Function
4 msgs
Felipe Carrillo Excel Trend Function Jul 12, 2008
Daniel Malter Excel Trend Function Jul 12, 2008
paulandpen Excel Trend Function Jul 13, 2008
Daniel Malter Excel Trend Function Jul 13, 2008
mpirun question with Rmpi
2 msgs
Erin Hodgess mpirun question with Rmpi Jul 11, 2008
Martin Morgan mpirun question with Rmpi Jul 13, 2008
Another packaging question
4 msgs
Johannes Hüsing Another packaging question Jul 11, 2008
Uwe Ligges Another packaging question Jul 12, 2008
Johannes Hüsing Another packaging question Jul 13, 2008
Uwe Ligges Another packaging question Jul 13, 2008
R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo
3 msgs
Law, Jason R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 8, 2008
Brian Ripley R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 13, 2008
Uwe Ligges R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 13, 2008
How to build a package which loads Rgraphviz (if installed)...
7 msgs
Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
William Revelle How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
Duncan Murdoch How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
William Revelle How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008
Uwe Ligges How to build a package which loads Rgraphviz (if installed)... Jul 13, 2008
shapiro wilk normality test
3 msgs
Bunny, lautloscrew.com shapiro wilk normality test Jul 12, 2008
Robert A LaBudde shapiro wilk normality test Jul 12, 2008
C.H. shapiro wilk normality test Jul 12, 2008
Another failed attempt to install an R package in Ubuntu
4 msgs
Miklos Kiss Another failed attempt to install an R package in Ubuntu Jul 11, 2008
Iain Gallagher Another failed attempt to install an R package in Ubuntu Jul 12, 2008
Matti Pastell Another failed attempt to install an R package in Ubuntu Jul 12, 2008
Vincent Goulet Another failed attempt to install an R package in Ubuntu Jul 12, 2008
a warning message from lmer
4 msgs
Lan Wei a warning message from lmer Jul 12, 2008
Douglas Bates a warning message from lmer Jul 12, 2008
Douglas Bates a warning message from lmer Jul 12, 2008
Lan Wei a warning message from lmer Jul 12, 2008
A (not so) Short Introduction to S4
1 msg
Christophe Genolini A (not so) Short Introduction to S4 Jul 12, 2008
Position in a vector of the last value > n
6 msgs
Thaden, John J Position in a vector of the last value > n Jul 10, 2008
Henrique Dallazuanna Position in a vector of the last value > n Jul 10, 2008
jim holtman Position in a vector of the last value > n Jul 10, 2008
Thaden, John J Position in a vector of the last value > n - *SOLVED* Jul 11, 2008
jim holtman Position in a vector of the last value > n - *SOLVED* Jul 12, 2008
Thaden, John J Position in a vector of the last value > n - *SOLVED* Jul 12, 2008
R-outlet: Journal of Statistical Software
1 msg
Jan de Leeuw R-outlet: Journal of Statistical Software Jul 12, 2008
shapiro wilk normality test
1 msg
Robert A LaBudde shapiro wilk normality test Jul 12, 2008
odfWeave problem in 7.1?
5 msgs
Jim Porzak odfWeave problem in 7.1? Jul 10, 2008
Jim Porzak odfWeave problem in 7.1? Jul 10, 2008
Dieter Menne odfWeave problem in 7.1? Jul 10, 2008
Jim Porzak odfWeave problem in 7.1? Jul 11, 2008
Brian Ripley odfWeave problem in 7.1? Jul 12, 2008
Reading Multi-value data fields for descriptive analysis (resend)
1 msg
Hohm, Dale Reading Multi-value data fields for descriptive analysis (resend) Jul 12, 2008
Help with error in "if then" statement
3 msgs
Andrew Rominger Help with error in "if then" statement Jul 11, 2008
Erik Iverson Help with error in "if then" statement Jul 11, 2008
John Kane Help with error in "if then" statement Jul 12, 2008
specifying data
4 msgs
sprohl at na.uni-tuebingen.de specifying data Jul 9, 2008
Daniel Malter specifying data Jul 10, 2008
PIKAL Petr Odp: specifying data Jul 10, 2008
hpdutra specifying data Jul 12, 2008
ggplot2 book?
1 msg
hpdutra ggplot2 book? Jul 12, 2008
Visualization of multiple alignments
1 msg
Schragi Schwartz Visualization of multiple alignments Jul 12, 2008
Help with arima.sim
2 msgs
Christopher Gürke Help with arima.sim Jul 12, 2008
Erin Hodgess Help with arima.sim Jul 12, 2008
data summerization etc...
4 msgs
sj data summerization etc... Jul 11, 2008
ajay ohri data summerization etc... Jul 11, 2008
Hadley Wickham data summerization etc... Jul 12, 2008
Gabor Grothendieck data summerization etc... Jul 12, 2008
Error of exp() in a dll from Fortran
2 msgs
Hao Ren Sr Error of exp() in a dll from Fortran Jul 12, 2008
Duncan Murdoch Error of exp() in a dll from Fortran Jul 12, 2008
plotting granular data
3 msgs
Neil Gupta plotting granular data Jul 11, 2008
jim holtman plotting granular data Jul 11, 2008
Jim Lemon plotting granular data Jul 12, 2008
Plot multiple datasets on a VCD ternary graph
2 msgs
theBenjamin Plot multiple datasets on a VCD ternary graph Jul 11, 2008
Jim Lemon Plot multiple datasets on a VCD ternary graph Jul 12, 2008
Lattice: merged strips?
6 msgs
Michael Lawrence Lattice: merged strips? Jul 9, 2008
Mike Lawrence Lattice: merged strips? Jul 9, 2008
Duncan Mackay Lattice: merged strips? Jul 9, 2008
Michael Lawrence Lattice: merged strips? Jul 10, 2008
Deepayan Sarkar Lattice: merged strips? Jul 11, 2008
Michael Lawrence Lattice: merged strips? Jul 11, 2008
data summarization etc...
3 msgs
sj data summarization etc... Jul 11, 2008
Daniel Malter data summarization etc... Jul 11, 2008
Daniel Malter data summarization etc... Jul 11, 2008
Start preferred RGui
8 msgs
marciarr Start preferred RGui Jul 11, 2008
Keith Jewell Start preferred RGui Jul 11, 2008
Gabor Grothendieck Start preferred RGui Jul 11, 2008
Ptit_Bleu Start preferred RGui Jul 11, 2008
Bart Joosen Start preferred RGui Jul 11, 2008
Keith Jewell Start preferred RGui Jul 11, 2008
Ptit_Bleu Start preferred RGui Jul 11, 2008
John C Frain Start preferred RGui Jul 11, 2008
List help
4 msgs
Rajasekaramya List help Jul 11, 2008
Henrique Dallazuanna List help Jul 11, 2008
Jorge Ivan Velez List help Jul 11, 2008
Rajasekaramya List help Jul 11, 2008
Comparing complex numbers
3 msgs
stoffer@pitt.edu Comparing complex numbers Jul 11, 2008
Duncan Murdoch Comparing complex numbers Jul 11, 2008
stoffer@pitt.edu Comparing complex numbers Jul 11, 2008
While loop
2 msgs
Rheannon While loop Jul 11, 2008
Henrique Dallazuanna While loop Jul 11, 2008
R bug in the update of nlme?
2 msgs
Susana Esteves R bug in the update of nlme? Jul 10, 2008
Spencer Graves R bug in the update of nlme? Jul 11, 2008
Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??
2 msgs
muhammad faisal Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? Jul 11, 2008
Brad McNeney Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? Jul 11, 2008
reading in a subset of a large data set
3 msgs
Stacey Burrows reading in a subset of a large data set Jul 11, 2008
jim holtman reading in a subset of a large data set Jul 11, 2008
Bert Gunter reading in a subset of a large data set Jul 11, 2008
GroupedData for three way randomized block. LME
1 msg
hpdutra GroupedData for three way randomized block. LME Jul 11, 2008
Ellipsis arguments for plot.formula
7 msgs
Amit Ganatra Ellipsis arguments for plot.formula Jul 10, 2008
Bert Gunter Ellipsis arguments for plot.formula Jul 10, 2008
Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008
Gabor Grothendieck Ellipsis arguments for plot.formula Jul 11, 2008
Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008
Gabor Grothendieck Ellipsis arguments for plot.formula Jul 11, 2008
Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008
Meaning of Positive LogLikelihood
2 msgs
Gundala Viswanath Meaning of Positive LogLikelihood Jul 11, 2008
Erik Iverson Meaning of Positive LogLikelihood Jul 11, 2008
network
3 msgs
Gábor Csárdi network Jul 11, 2008
Dry, Jonathan R network Jul 11, 2008
Gábor Csárdi network Jul 11, 2008
modified ks.test?
1 msg
Shuhua Zhan modified ks.test? Jul 11, 2008
network
2 msgs
Dry, Jonathan R network Jul 11, 2008
Gábor Csárdi network Jul 11, 2008
Funnel plots
1 msg
Januarius Funnel plots Jul 11, 2008
Manipulate Data (with regular expressions)
6 msgs
Kunzler, Andreas Manipulate Data (with regular expressions) Jul 8, 2008
oscar Linares Manipulate Data (with regular expressions) Jul 8, 2008
Gabor Grothendieck Manipulate Data (with regular expressions) Jul 8, 2008
Kunzler, Andreas Manipulate Data (with regular expressions) Jul 11, 2008
Kenn Konstabel Manipulate Data (with regular expressions) Jul 11, 2008
Gabor Grothendieck Manipulate Data (with regular expressions) Jul 11, 2008
shifting data in matrix by n rows
10 msgs
rcoder shifting data in matrix by n rows Jul 9, 2008
jim holtman shifting data in matrix by n rows Jul 9, 2008
rcoder shifting data in matrix by n rows Jul 9, 2008
Gabor Grothendieck shifting data in matrix by n rows Jul 9, 2008
jim holtman shifting data in matrix by n rows Jul 9, 2008
rcoder shifting data in matrix by n rows Jul 10, 2008
Gabor Grothendieck shifting data in matrix by n rows Jul 10, 2008
Gabor Grothendieck shifting data in matrix by n rows Jul 10, 2008
rcoder shifting data in matrix by n rows Jul 10, 2008
Gabor Grothendieck shifting data in matrix by n rows Jul 11, 2008
Funnel plots in r
1 msg
Januarius Funnel plots in r Jul 11, 2008
how to test this multivariate normal distribution?
1 msg
domenico pestalozzi how to test this multivariate normal distribution? Jul 11, 2008
rounding
7 msgs
Korn, Ed (NIH/NCI) [E] rounding Jul 10, 2008
Rolf Turner rounding Jul 10, 2008
ctu at bigred.unl.edu rounding Jul 10, 2008
Moshe Olshansky rounding Jul 10, 2008
Moshe Olshansky rounding Jul 10, 2008
jim holtman rounding Jul 10, 2008
Jim Lemon rounding Jul 11, 2008
How to output 0.405852702657738 as 0.405853 ?
2 msgs
Daren Tan How to output 0.405852702657738 as 0.405853 ? Jul 10, 2008
ctu at bigred.unl.edu How to output 0.405852702657738 as 0.405853 ? Jul 10, 2008
number of effective tests
4 msgs
Georg Ehret number of effective tests Jul 10, 2008
Moshe Olshansky number of effective tests Jul 10, 2008
Daniel Malter number of effective tests Jul 10, 2008
Charles C. Berry number of effective tests Jul 10, 2008
embarrassingly parallel problem - simple loop solution
2 msgs
Chris Gaiteri embarrassingly parallel problem - simple loop solution Jul 10, 2008
Martin Morgan embarrassingly parallel problem - simple loop solution Jul 10, 2008
Problems with Package Installation.
3 msgs
Sam Albers Problems with Package Installation. Jul 10, 2008
Erik Iverson Problems with Package Installation. Jul 10, 2008
Rolf Turner Problems with Package Installation. Jul 10, 2008
search with help.start
2 msgs
Carlisle Thacker search with help.start Jul 10, 2008
Marc Schwartz search with help.start Jul 10, 2008
princomp loading help
3 msgs
Wu, Hong-Sheng princomp loading help Jul 10, 2008
Daniel Malter princomp loading help Jul 10, 2008
Bert Gunter princomp loading help Jul 10, 2008
Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP)
3 msgs
DaveFrisch Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP) Jul 10, 2008
(Ted Harding) Interpretation of EXACT Statistical Test in finding the Jul 10, 2008
DaveFrisch Interpretation of EXACT Statistical Test in finding the Jul 10, 2008
layout is to xyplot as ??? is to qplot
2 msgs
Jim Price layout is to xyplot as ??? is to qplot Jul 10, 2008
Hadley Wickham layout is to xyplot as ??? is to qplot Jul 10, 2008
predict.garch problem
1 msg
Shirin Safa predict.garch problem Jul 10, 2008
RE volution
1 msg
Mariana Gamb RE volution Jul 10, 2008
compiling pnmath on an intel processor running mac OS 10.5
2 msgs
Michael Lawrence compiling pnmath on an intel processor running mac OS 10.5 Jul 10, 2008
Luke Tierney compiling pnmath on an intel processor running mac OS 10.5 Jul 10, 2008
Operator overloading
5 msgs
Tine Operator overloading Jul 10, 2008
Peter Dalgaard Operator overloading Jul 10, 2008
Hadley Wickham Operator overloading Jul 10, 2008
Peter Dalgaard Operator overloading Jul 10, 2008
Spencer Graves Operator overloading Jul 10, 2008
Sorting a matrix
4 msgs
Angelo Scozzarella Sorting a matrix Jul 10, 2008
Jorge Ivan Velez Sorting a matrix Jul 10, 2008
Erik Iverson Sorting a matrix Jul 10, 2008
Bert Gunter Sorting a matrix Jul 10, 2008
What's the T-Value in fisher.test
4 msgs
DaveFrisch What's the T-Value in fisher.test Jul 10, 2008
Peter Dalgaard What's the T-Value in fisher.test Jul 10, 2008
ctu at bigred.unl.edu What's the T-Value in fisher.test Jul 10, 2008
(Ted Harding) What's the T-Value in fisher.test Jul 10, 2008
xYplot customizing y-axis scaling
4 msgs
Henning Wildhagen xYplot customizing y-axis scaling Jul 10, 2008
Christoph Meyer xYplot customizing y-axis scaling Jul 10, 2008
Ben Bolker xYplot customizing y-axis scaling Jul 10, 2008
Ben Bolker xYplot customizing y-axis scaling Jul 10, 2008
Help on Installing Matrix Package in Linux (Fedora)
1 msg
Hyunseung Kang Help on Installing Matrix Package in Linux (Fedora) Jul 10, 2008
Parallel R
3 msgs
Juan Pablo Romero Méndez Parallel R Jul 9, 2008
Martin Morgan Parallel R Jul 10, 2008
Luke Tierney Parallel R Jul 10, 2008
Rmpi unkown input format error
1 msg
Lyman, Mark Rmpi unkown input format error Jul 10, 2008
Non-normal data issues in PhD software engineering experiment
4 msgs
Andrew Jackson Non-normal data issues in PhD software engineering experiment Jul 10, 2008
Daniel Malter Non-normal data issues in PhD software engineering experiment Jul 10, 2008
Gustaf Rydevik Non-normal data issues in PhD software engineering experiment Jul 10, 2008
Hadley Wickham Non-normal data issues in PhD software engineering experiment Jul 10, 2008
S4 class questions
2 msgs
Li, Xuejun S4 class questions Jul 10, 2008
Martin Morgan S4 class questions Jul 10, 2008
by() function doesn't work inside another function
1 msg
Russell Ivory by() function doesn't work inside another function Jul 10, 2008
ppls: version 1.02 including a new data set
1 msg
Nicole Krämer ppls: version 1.02 including a new data set Jul 10, 2008
ace error because of missings?
1 msg
Birgitle ace error because of missings? Jul 10, 2008
How to check how much memory has been used or reserved ?
1 msg
Daren Tan How to check how much memory has been used or reserved ? Jul 10, 2008
false discovery rate !
2 msgs
A Ezhil false discovery rate ! Jul 10, 2008
john seers (IFR) false discovery rate ! Jul 10, 2008
Interpolation of data
4 msgs
sprohl at na.uni-tuebingen.de Interpolation of data Jul 9, 2008
Daniel Malter Interpolation of data Jul 10, 2008
stephen sefick Interpolation of data Jul 10, 2008
Michael Lawrence Interpolation of data Jul 10, 2008
Interpolation of data
1 msg
Don MacQueen Interpolation of data Jul 10, 2008
Non-normal data issues in PhD software engineering experiment
1 msg
andrewjacksonTCD Non-normal data issues in PhD software engineering experiment Jul 10, 2008
rbinom for a matrix
9 msgs
ACroske rbinom for a matrix Jul 9, 2008
Erik Iverson rbinom for a matrix Jul 9, 2008
Ben Bolker rbinom for a matrix Jul 9, 2008
Dylan Beaudette rbinom for a matrix Jul 9, 2008
ACroske rbinom for a matrix Jul 9, 2008
Ben Bolker rbinom for a matrix Jul 9, 2008
ACroske rbinom for a matrix Jul 9, 2008
Dylan Beaudette rbinom for a matrix Jul 9, 2008
Ben Bolker rbinom for a matrix Jul 10, 2008
Issue with postscript figures using WinAnsi encoding
2 msgs
Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 6, 2008
Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 10, 2008
build matrix with the content of one column of a data frame in function of two factors
3 msgs
VinceD build matrix with the content of one column of a data frame in function of two factors Jul 9, 2008
VinceD build matrix with the content of one column of a data frame in function of two factors Jul 9, 2008
VinceD build matrix with the content of one column of a data frame in function of two factors Jul 10, 2008
Turn any vector
6 msgs
Zroutik Zroutik Turn any vector Jul 10, 2008
Henrique Dallazuanna Turn any vector Jul 10, 2008
Gábor Csárdi Turn any vector Jul 10, 2008
jim holtman Turn any vector Jul 10, 2008
Javier Garcia-Pintado Turn any vector Jul 10, 2008
Zroutik Zroutik Turn any vector Jul 10, 2008
Bootstrap in betareg()
1 msg
Leandro Marino Bootstrap in betareg() Jul 10, 2008
problems with rq.fit.sfn
1 msg
alessia matano problems with rq.fit.sfn Jul 10, 2008
version problems of rkward in ubuntu hardy repository
3 msgs
Rainer M Krug version problems of rkward in ubuntu hardy repository Jul 9, 2008
Vincent Goulet version problems of rkward in ubuntu hardy repository Jul 9, 2008
Rainer M Krug version problems of rkward in ubuntu hardy repository Jul 10, 2008
quantile regression estimation results
2 msgs
Emili Tortosa-Ausina quantile regression estimation results Jul 10, 2008
Roger Koenker quantile regression estimation results Jul 10, 2008
Grid building in R
8 msgs
Sam Albers Grid building in R Jul 9, 2008
Hadley Wickham Grid building in R Jul 9, 2008
Sam Albers Grid building in R Jul 9, 2008
Erik Iverson Grid building in R Jul 9, 2008
Sam Albers Grid building in R Jul 9, 2008
Dylan Beaudette Grid building in R Jul 9, 2008
Sam Albers Grid building in R Jul 9, 2008
Jim Lemon Grid building in R Jul 10, 2008
Sorting / editing a table
3 msgs
Jörg Groß Sorting / editing a table Jul 10, 2008
Daniel Malter Sorting / editing a table Jul 10, 2008
Tobias Verbeke Sorting / editing a table Jul 10, 2008
Sorting / editing a table
1 msg
Wacek Kusnierczyk Sorting / editing a table Jul 10, 2008
Plot depends on conditions
3 msgs
mysimbaa Plot depends on conditions Jul 7, 2008
jim holtman Plot depends on conditions Jul 7, 2008
mysimbaa Plot depends on conditions Jul 10, 2008
Find the closest value in a list or matrix
7 msgs
R_Learner Find the closest value in a list or matrix Jul 9, 2008
Henrique Dallazuanna Find the closest value in a list or matrix Jul 9, 2008
Daniel Malter Find the closest value in a list or matrix Jul 9, 2008
Tobias Verbeke Find the closest value in a list or matrix Jul 9, 2008
Jorge Ivan Velez Find the closest value in a list or matrix Jul 9, 2008
R_Learner Thanks! Jul 9, 2008
PIKAL Petr Thanks! Jul 10, 2008
read.table problem
2 msgs
phoebe kong read.table problem Jul 9, 2008
Schleuh re ad.table problem Jul 10, 2008
problems with rq.fit.sfn
1 msg
alessia matano problems with rq.fit.sfn Jul 10, 2008
Problem when building a test R package on PC
1 msg
Briantgr Problem when building a test R package on PC Jul 10, 2008
Parsing
1 msg
Paolo Sonego Parsing Jul 10, 2008
“Check” problem
2 msgs
leeznar “Check” problem Jul 9, 2008
Peter Dalgaard “Check” problem Jul 10, 2008
childNames for xaxis grob (grid package)
3 msgs
Tobias Verbeke childNames for xaxis grob (grid package) Jul 9, 2008
Paul Murrell childNames for xaxis grob (grid package) Jul 9, 2008
Tobias Verbeke childNames for xaxis grob (grid package) Jul 10, 2008
Finding Values that Occur Most Often in a Vector
3 msgs
Gundala Viswanath Finding Values that Occur Most Often in a Vector Jul 9, 2008
Hervé Pagès Finding Values that Occur Most Often in a Vector Jul 9, 2008
Duncan Mackay Finding Values that Occur Most Often in a Vector Jul 9, 2008
Help on Installing Matrix Package in Linux (Fedora)
3 msgs
Hyunseung Kang Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008
Krzysztof Sakrejda Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008
Marc Schwartz Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008
Basic help needed
2 msgs
Luciano La Sala Basic help needed Jul 9, 2008
Gabor Grothendieck Basic help needed Jul 9, 2008
Strptime/ date time classes
6 msgs
Caroline Keef Strptime/ date time classes Jul 9, 2008
jim holtman Strptime/ date time classes Jul 9, 2008
Mark Difford Strptime/ date time classes Jul 9, 2008
Caroline Keef Strptime/ date time classes Jul 9, 2008
jim holtman Strptime/ date time classes Jul 9, 2008
Gabor Grothendieck Strptime/ date time classes Jul 9, 2008
Summary Stats (not summary(x))
10 msgs
nmarti Summary Stats (not summary(x)) Jul 9, 2008
Jorge Ivan Velez Summary Stats (not summary(x)) Jul 9, 2008
Gabor Grothendieck Summary Stats (not summary(x)) Jul 9, 2008
Gábor Csárdi Summary Stats (not summary(x)) Jul 9, 2008
HBaize Summary Stats (not summary(x)) Jul 9, 2008
nmarti Summary Stats (not summary(x)) Jul 9, 2008
William Revelle Summary Stats (not summary(x)) Jul 9, 2008
nmarti Summary Stats (not summary(x)) Jul 9, 2008
nmarti Summary Stats (not summary(x)) Jul 9, 2008
Gabor Grothendieck Summary Stats (not summary(x)) Jul 9, 2008
Sweave figure
2 msgs
Georg Otto Sweave figure Jul 9, 2008
Duncan Murdoch Sweave figure Jul 9, 2008
Help navigating documentation for descriptive statistics
1 msg
Ted Help navigating documentation for descriptive statistics Jul 9, 2008
use variable value as vector name
2 msgs
Qian R use variable value as vector name Jul 9, 2008
Erik Iverson use variable value as vector name Jul 9, 2008
aggregate() function and na.rm = TRUE
7 msgs
David Afshartous aggregate() function and na.rm = TRUE Jul 8, 2008
Daniel Malter aggregate() function and na.rm = TRUE Jul 8, 2008
David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008
Deepayan Sarkar Auto.key colors maintained when subsetting Jul 9, 2008
David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008
Deepayan Sarkar Auto.key colors maintained when subsetting Jul 9, 2008
David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008
zoo and cex
2 msgs
stephen sefick zoo and cex Jul 9, 2008
Marc Schwartz zoo and cex Jul 9, 2008
recursively divide a value to get a sequence
2 msgs
Carl Witthoft recursively divide a value to get a sequence Jul 9, 2008
Erik Iverson recursively divide a value to get a sequence Jul 9, 2008
randomly select duplicated entries
4 msgs
Juliet Hannah randomly select duplicated entries Jul 9, 2008
Henrique Dallazuanna randomly select duplicated entries Jul 9, 2008
jim holtman randomly select duplicated entries Jul 9, 2008
Marc Schwartz randomly select duplicated entries Jul 9, 2008
Read.table - Less rows than original data
3 msgs
phoebe kong Read.table - Less rows than original data Jul 9, 2008
Ben Bolker Read.table - Less rows than original data Jul 9, 2008
Philipp Pagel Read.table - Less rows than original data Jul 9, 2008
Port package
6 msgs
Jos Kaefer Port package Jul 9, 2008
Roger Koenker Port package Jul 9, 2008
Katharine Mullen Port package Jul 9, 2008
Roger Koenker Port package Jul 9, 2008
Ben Bolker Port package Jul 9, 2008
Hadley Wickham Port package Jul 9, 2008
matplot help
1 msg
Boyce, Morgan matplot help Jul 9, 2008
Question regarding lu in package Matrix
3 msgs
Ulrike Grömping Question regarding lu in package Matrix Jul 9, 2008
Douglas Bates Question regarding lu in package Matrix Jul 9, 2008
Ulrike Grömping Question regarding lu in package Matrix Jul 9, 2008
netCDF to TIFF
2 msgs
Daniel Steinberg netCDF to TIFF Jul 9, 2008
Yasir Kaheil netCDF to TIFF Jul 9, 2008
ftp directory
1 msg
Yuri Volchik ftp directory Jul 9, 2008
garchFit problem
1 msg
Shirin Safa garchFit problem Jul 9, 2008
outlining symbol in legend with blackline
2 msgs
stephen sefick outlining symbol in legend with blackline Jul 9, 2008
Yasir Kaheil outlining symbol in legend with blackline Jul 9, 2008
"Rotated Lat-Lon" projection in mapproj
1 msg
Víctor Homar Santaner "Rotated Lat-Lon" projection in mapproj Jul 9, 2008
plot gam "main effect functions" in one graph
2 msgs
Pancrazio Bertaccini plot gam "main effect functions" in one graph Jul 9, 2008
Daniel Malter plot gam "main effect functions" in one graph Jul 9, 2008
question on FARIMA innovations
1 msg
otunno at CLEMSON.EDU question on FARIMA innovations Jul 9, 2008
rollmean()
3 msgs
Rheannon rollmean() Jul 9, 2008
Gabor Grothendieck rollmean() Jul 9, 2008
stephen sefick rollmean() Jul 9, 2008
package segmented problem
2 msgs
Alan Kelly package segmented problem Jul 8, 2008
milton ruser package segmented problem Jul 9, 2008
Parsing
6 msgs
Paolo Sonego Parsing Jul 9, 2008
jim holtman Parsing Jul 9, 2008
Paolo Sonego Parsing Jul 9, 2008
jim holtman Parsing Jul 9, 2008
Paolo Sonego Parsing Jul 9, 2008
jim holtman Parsing Jul 9, 2008
gsub and "\"
4 msgs
Sean Davis gsub and "\" Jul 9, 2008
jim holtman gsub and "\" Jul 9, 2008
Sean Davis gsub and "\" Jul 9, 2008
(Ted Harding) gsub and "\" Jul 9, 2008
rJava crashes jvm
1 msg
Christian Ruckert rJava crashes jvm Jul 9, 2008
lapply
2 msgs
Rajasekaramya lapply Jul 9, 2008
jim holtman lapply Jul 9, 2008
Loglikelihood for x factorial?
2 msgs
ctu at bigred.unl.edu Loglikelihood for x factorial? Jul 8, 2008
Ben Bolker Loglikelihood for x factorial? Jul 9, 2008
recursively divide a value to get a sequence
2 msgs
René Capell recursively divide a value to get a sequence Jul 9, 2008
Wacek Kusnierczyk recursively divide a value to get a sequence Jul 9, 2008
making zoo objects with zoo without format argument?
11 msgs
stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008
Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008
Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008
stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008
stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008
Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008
stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008
Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008
stephen sefick making zoo objects with zoo without format argument? Jul 9, 2008
stephen sefick making zoo objects with zoo without format argument? Jul 9, 2008
Gabor Grothendieck making zoo objects with zoo without format argument? Jul 9, 2008
Expression in axis
1 msg
S Ellison Expression in axis Jul 9, 2008
Help with installing add-on packages
1 msg
Miha Staut Help with installing add-on packages Jul 9, 2008
extracting index list when using tapply()
5 msgs
hesicaia extracting index list when using tapply() Jul 8, 2008
ctu at bigred.unl.edu extracting index list when using tapply() Jul 8, 2008
Charles C. Berry extracting index list when using tapply() Jul 8, 2008
jim holtman extracting index list when using tapply() Jul 8, 2008
hesicaia extracting index list when using tapply() Jul 9, 2008
replacing value in column of data frame
3 msgs
Booman, M replacing value in column of data frame Jul 9, 2008
Daniel Malter replacing value in column of data frame Jul 9, 2008
jim holtman replacing value in column of data frame Jul 9, 2008
Automatic placement of Legends
9 msgs
tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 8, 2008
stephen sefick Automatic placement of Legends Jul 8, 2008
Boks, M.P.M. Automatic placement of Legends Jul 8, 2008
dogle Automatic placement of Legends Jul 8, 2008
Gregor Gorjanc Automatic placement of Legends Jul 8, 2008
tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 9, 2008
Jim Lemon Automatic placement of Legends Jul 9, 2008
Frank E Harrell Jr Automatic placement of Legends Jul 9, 2008
tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 9, 2008
recursively divide a value to get a sequence
8 msgs
Anne-Marie Ternes recursively divide a value to get a sequence Jul 9, 2008
Daniel Malter recursively divide a value to get a sequence Jul 9, 2008
Jim Lemon recursively divide a value to get a sequence Jul 9, 2008
Bart Joosen re cursively divide a value to get a sequence Jul 9, 2008
Keith Jewell recursively divide a value to get a sequence Jul 9, 2008
Anne-Marie Ternes recursively divide a value to get a sequence Jul 9, 2008
Gabor Grothendieck recursively divide a value to get a sequence Jul 9, 2008
Berwin A Turlach recursively divide a value to get a sequence Jul 9, 2008
RJDBC and OracleDriver: unable to connect
1 msg
Rodrigo Santamaria RJDBC and OracleDriver: unable to connect Jul 9, 2008
problems using mice()
1 msg
Birgitle problems using mice() Jul 9, 2008
Question concerning Furness iteration & subprogram/modules
1 msg
Mario Cools Question concerning Furness iteration & subprogram/modules Jul 9, 2008
"non-sample" standard-deviation
2 msgs
el_eli at gmx.de "non-sample" standard-deviation Jul 9, 2008
Daniel Malter "non-sample" standard-deviation Jul 9, 2008
Change in behaviour of sd()
6 msgs
Fiona Johnson Change in behaviour of sd() Jul 8, 2008
Rolf Turner Change in behaviour of sd() Jul 8, 2008
Henrik Bengtsson Change in behaviour of sd() Jul 8, 2008
Duncan Murdoch Change in behaviour of sd() Jul 8, 2008
Peter Dalgaard Change in behaviour of sd() Jul 8, 2008
Jim Lemon Change in behaviour of sd() Jul 9, 2008
Expression in axis
4 msgs
Dani Valverde Expression in axis Jul 9, 2008
Daniel Malter Expression in axis Jul 9, 2008
Gábor Csárdi Expression in axis Jul 9, 2008
Daniel Malter Expression in axis Jul 9, 2008
building experimental paradigm with R as "Brainard/Pelli Psych Toolbox"
2 msgs
guillaume chaumet building experimental paradigm with R as "Brainard/Pelli Psych Toolbox" Jul 9, 2008
Ken Knoblauch building experimental paradigm with R as "Brainard/Pelli PsychToolbox" Jul 9, 2008
Help with installing add-on packages
1 msg
Miha Staut Help with installing add-on packages Jul 9, 2008
cex.axis for the x axis
3 msgs
Pavel77 cex.axis for the x axis Jul 8, 2008
Mark Difford cex.axis for the x axis Jul 9, 2008
Mark Difford cex.axis for the x axis Jul 9, 2008
Installing R package but got Fortran 90 error
1 msg
Daren Tan Installing R package but got Fortran 90 error Jul 8, 2008
sorting a data frame by rownames
3 msgs
Michael Rennie sorting a data frame by rownames Jul 8, 2008
Rolf Turner sorting a data frame by rownames Jul 8, 2008
Jorge Ivan Velez sorting a data frame by rownames Jul 8, 2008
Can I do regression by steps?
4 msgs
rlearner309 Can I do regression by steps? Jul 8, 2008
John Sorkin Can I do regression by steps? Jul 8, 2008
rlearner309 Can I do regression by steps? Jul 8, 2008
John Sorkin Can I do regression by steps? Jul 8, 2008
Can I do regression by steps?
1 msg
Mark Leeds Can I do regression by steps? Jul 8, 2008
question on lm or glm matrix of coeficients X test data terms
1 msg
DS question on lm or glm matrix of coeficients X test data terms Jul 8, 2008
question on lm or glm matrix of coeficients X test data terms
1 msg
DS question on lm or glm matrix of coeficients X test data terms Jul 8, 2008
Sum(Random Numbers)=100
1 msg
Carl Witthoft Sum(Random Numbers)=100 Jul 8, 2008
calculation of entropy in R???
2 msgs
muhammad faisal calculation of entropy in R??? Jul 8, 2008
David Reinke calculation of entropy in R??? Jul 8, 2008
shading an area in a edf
2 msgs
squall44 shading an area in a edf Jul 8, 2008
Ray Brownrigg shading an area in a edf Jul 8, 2008
Sum(Random Numbers)=100
11 msgs
Moshe Olshansky Sum(Random Numbers)=100 Jul 7, 2008
Shubha Vishwanath Karanth Sum(Random Numbers)=100 Jul 7, 2008
Peng Jiang Sum(Random Numbers)=100 Jul 7, 2008
Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008
Moshe Olshansky Sum(Random Numbers)=100 Jul 8, 2008
Richard Pearson Sum(Random Numbers)=100 Jul 8, 2008
Peter Dalgaard Sum(Random Numbers)=100 Jul 8, 2008
Patrick Burns Sum(Random Numbers)=100 Jul 8, 2008
Leandro Marino RES: Sum(Random Numbers)=100 Jul 8, 2008
Hanke, Alex Sum(Random Numbers)=100 Jul 8, 2008
Kenn Konstabel Sum(Random Numbers)=100 Jul 8, 2008
nls and "plinear" algorithm
4 msgs
Allan Clark nls and "plinear" algorithm Jul 8, 2008
Duncan Murdoch nls and "plinear" algorithm Jul 8, 2008
Peter Dalgaard nls and "plinear" algorithm Jul 8, 2008
Katharine Mullen nls and "plinear" algorithm Jul 8, 2008
extracting index list when using tapply()
1 msg
ctu at bigred.unl.edu extracting index list when using tapply() Jul 8, 2008
time series by calendar week
4 msgs
collonil time series by calendar week Jul 8, 2008
stephen sefick time series by calendar week Jul 8, 2008
Jeffrey J. Hallman time series by calendar week Jul 8, 2008
Gabor Grothendieck time series by calendar week Jul 8, 2008
fisher.test
1 msg
Marta Colombo fisher.test Jul 8, 2008
Plot
2 msgs
Paul Adams Plot Jul 8, 2008
stephen sefick Plot Jul 8, 2008
How I count the all possible samples??
3 msgs
muhammad faisal How I count the all possible samples?? Jul 8, 2008
Jorge Ivan Velez How I count the all possible samples?? Jul 8, 2008
John Kane How I count the all possible samples?? Jul 8, 2008
Gage R & R
1 msg
Isabella Ghement Gage R & R Jul 8, 2008
Constrained optimization
2 msgs
Kanak Choudhury Constrained optimization Jul 8, 2008
Paul Smith Constrained optimization Jul 8, 2008
fisher.test
1 msg
Marta Colombo fisher.test Jul 8, 2008
Question: Beginner stuck in a R cycle
1 msg
Gustaf Rydevik Question: Beginner stuck in a R cycle Jul 8, 2008
How to draw dot plots for 2 vectors seperately
1 msg
ss How to draw dot plots for 2 vectors seperately Jul 8, 2008
Change language in Rcmdr
5 msgs
Schleuh Change language in Rcmdr Jul 7, 2008
Duncan Murdoch Change language in Rcmdr Jul 7, 2008
Philippe GROSJEAN Change language in Rcmdr Jul 7, 2008
John Fox Change language in Rcmdr Jul 7, 2008
Adrian Dusa Change language in Rcmdr Jul 8, 2008
Need ideas on how to show spikes in my data and how to code it in R
1 msg
Thomas Fröjd Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008
simulate data for lme
1 msg
melanie.r simulate data for lme Jul 8, 2008
attributing values to dataframe positions following eval
3 msgs
Stephane Bourgeois attributing values to dataframe positions following eval Jul 8, 2008
John Kane attributing values to dataframe positions following eval Jul 8, 2008
Greg Snow attributing values to dataframe positions following eval Jul 8, 2008
about EM algorithm
2 msgs
Peng Jiang about EM algorithm Jul 8, 2008
Patrick Burns about EM algorithm Jul 8, 2008
Histogram with colors according to factor
5 msgs
Hans W Borchers Histogram with colors according to factor Jul 8, 2008
ONKELINX, Thierry Histogram with colors according to factor Jul 8, 2008
Hans W Borchers Histogram with colors according to factor Jul 8, 2008
ONKELINX, Thierry Histogram with colors according to factor Jul 8, 2008
Hadley Wickham Histogram with colors according to factor Jul 8, 2008
Specific question on LDheatmap
1 msg
Boks, M.P.M. Specific question on LDheatmap Jul 8, 2008
help for xvalid with external data
1 msg
Giovanni Bacaro help for xvalid with external data Jul 8, 2008
one-site competition data // curve fitting
4 msgs
Thiemo Schreiber one-site competition data // curve fitting Jul 7, 2008
Joerg van den Hoff one-site competition data // curve fitting Jul 8, 2008
Gabor Grothendieck one-site competition data // curve fitting Jul 8, 2008
Ben Bolker one-site competition data // curve fitting Jul 8, 2008
workspace platform potabillity
1 msg
Benjamin Otto workspace platform potabillity Jul 8, 2008
Help with eigenvectors
2 msgs
Francisco Javier Santos Alamillos Help with eigenvectors Jul 8, 2008
Ben Bolker Help with eigenvectors Jul 8, 2008
How to change labels in a histogram
1 msg
S Ellison How to change labels in a histogram Jul 8, 2008
Need ideas on how to show spikes in my data and how to code it in R
1 msg
S Ellison Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008
Multiple Plots and y Axis Labels
1 msg
jonboym Multiple Plots and y Axis Labels Jul 8, 2008
Need ideas on how to show spikes in my data and how to code it in R
1 msg
Thomas Fröjd Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008
Change legend in the 'hydrogeo' package
1 msg
Tomas Lanczos Change legend in the 'hydrogeo' package Jul 8, 2008
forecast & xreg
1 msg
Vorlow Constantinos forecast & xreg Jul 8, 2008
Problems with lm()
3 msgs
Chibisi Chima-Okereke Problems with lm() Jul 7, 2008
Daniel Malter Problems with lm() Jul 7, 2008
Chibisi Chima-Okereke Problems with lm() Jul 8, 2008
Can R do this ?
5 msgs
Daren Tan Can R do this ? Jul 7, 2008
Paul Smith Can R do this ? Jul 8, 2008
Gábor Csárdi Can R do this ? Jul 8, 2008
Mark Difford Can R do this ? Jul 8, 2008
Gábor Csárdi Can R do this ? Jul 8, 2008
How to change labels in a histogram
2 msgs
Lord Yo How to change labels in a histogram Jul 8, 2008
Philipp Pagel How to change labels in a histogram Jul 8, 2008
what does this warning mean ?
1 msg
Peng Jiang what does this warning mean ? Jul 8, 2008
Sum(Random Numbers)=100
4 msgs
Shubha Vishwanath Karanth Sum(Random Numbers)=100 Jul 7, 2008
Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008
Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008
Bill Venables Sum(Random Numbers)=100 Jul 8, 2008
Survey questions
2 msgs
Farley, Robert Survey questions Jul 7, 2008
Tobias Verbeke Survey questions Jul 8, 2008
odd dnorm behaviour (?)
4 msgs
Michael Lawrence odd dnorm behaviour (?) Jul 7, 2008
Michael Lawrence odd dnorm behaviour (?) Jul 7, 2008
Moshe Olshansky odd dnorm behaviour (?) Jul 7, 2008
Charles C. Berry odd dnorm behaviour (?) Jul 7, 2008
list genes w/n a genomic fragment
3 msgs
runner list genes w/n a genomic fragment Jul 7, 2008
Bert Gunter list genes w/n a genomic fragment Jul 7, 2008
Martin Morgan list genes w/n a genomic fragment Jul 7, 2008
Interpreting messages when building packages
8 msgs
Johannes Hüsing Interpreting messages when building packages Jul 6, 2008
Duncan Murdoch Interpreting messages when building packages Jul 6, 2008
Johannes Hüsing Interpreting messages when building packages Jul 7, 2008
Duncan Murdoch Interpreting messages when building packages Jul 7, 2008
Johannes Hüsing Interpreting messages when building packages Jul 7, 2008
Duncan Murdoch Interpreting messages when building packages Jul 7, 2008
Johannes Hüsing Interpreting messages when building packages Jul 7, 2008
Johannes Hüsing Interpreting messages when building packages Jul 7, 2008
Basic Vector and Matrix Operations
6 msgs
Eric Turkheimer Basic Vector and Matrix Operations Jul 7, 2008
Xiaohui Chen Basic Vector and Matrix Operations Jul 7, 2008
apjaworski@mmm.com Basic Vector and Matrix Operations Jul 7, 2008
Jorge Ivan Velez Basic Vector and Matrix Operations Jul 7, 2008
Erik Iverson Basic Vector and Matrix Operations Jul 7, 2008
jim holtman Basic Vector and Matrix Operations Jul 7, 2008
question on lm or glm matrix of coeficients X test data terms
1 msg
DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008
question on lm or glm matrix of coeficients X test data terms
1 msg
DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008
question on lm or glm matrix of coeficients X test data terms
2 msgs
DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008
Jorge Ivan Velez question on lm or glm matrix of coeficients X test data terms Jul 7, 2008
GLM, LMER, GEE interpretation
6 msgs
Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008
Ben Bolker GLM, LMER, GEE interpretation Jul 7, 2008
ctu at bigred.unl.edu GLM, LMER, GEE interpretation Jul 7, 2008
Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008
Ben Bolker GLM, LMER, GEE interpretation Jul 7, 2008
Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008
multiplication question
8 msgs
Murali Menon multiplication question Jul 2, 2008
Peter Alspach multiplication question Jul 2, 2008
N. Lapidus multiplication question Jul 2, 2008
Henrique Dallazuanna multiplication question Jul 2, 2008
Henrique Dallazuanna multiplication question Jul 2, 2008
Kenn Konstabel multiplication question Jul 2, 2008
Murali Menon multiplication question Jul 3, 2008
Moshe Olshansky multiplication question Jul 7, 2008
Drawing a colour wheel - bug in hcl?
8 msgs
Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008
Earl F. Glynn Drawing a colour wheel - bug in hcl? Jul 7, 2008
Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008
Earl F. Glynn Drawing a colour wheel - bug in hcl? Jul 7, 2008
Achim Zeileis Drawing a colour wheel - bug in hcl? Jul 7, 2008
Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008
Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008
Achim Zeileis Drawing a colour wheel - bug in hcl? Jul 7, 2008
Interest in a Use R Group in San Francisco area?
5 msgs
Jim Porzak Interest in a Use R Group in San Francisco area? Jul 7, 2008
Marc Schwartz Interest in a Use R Group in San Francisco area? Jul 7, 2008
Peter Dalgaard Interest in a Use R Group in San Francisco area? Jul 7, 2008
Marc Schwartz Interest in a Use R Group in San Francisco area? Jul 7, 2008
Peter Dalgaard Interest in a Use R Group in San Francisco area? Jul 7, 2008
indicating significant differences in boxplots
3 msgs
Sebastian Merz indicating significant differences in boxplots Jul 7, 2008
Jim Lemon indicating significant differences in boxplots Jul 7, 2008
John Kane indicating significant differences in boxplots Jul 7, 2008
Colour clusters in a 2d plot
3 msgs
Josep Maria Campanera Alsina Colour clusters in a 2d plot Jul 7, 2008
Jorge Ivan Velez Colour clusters in a 2d plot Jul 7, 2008
Hadley Wickham Colour clusters in a 2d plot Jul 7, 2008
subset() multiple arguments
4 msgs
stephen sefick subset() multiple arguments Jul 7, 2008
Henrique Dallazuanna subset() multiple arguments Jul 7, 2008
Duncan Murdoch subset() multiple arguments Jul 7, 2008
Peter Dalgaard subset() multiple arguments Jul 7, 2008
A shorter version of ".Last.value"?
4 msgs
Jon Zadra A shorter version of ".Last.value"? Jul 7, 2008
Gabor Grothendieck A shorter version of ".Last.value"? Jul 7, 2008
Peter Dalgaard A shorter version of ".Last.value"? Jul 7, 2008
Peter Dalgaard A shorter version of ".Last.value"? Jul 7, 2008
Relative Mortality Risk second part
1 msg
Terry Therneau Relative Mortality Risk second part Jul 7, 2008
Running "all possible subsets" of a GLM (binomial) model
3 msgs
Eric Vander Wal Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008
Hadley Wickham Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008
Ben Bolker Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008
Method for checking automatically which distribtions fits a data
5 msgs
Satoshi Takahama Method for checking automatically which distribtions fits a data Jul 7, 2008
Ben Bolker Method for checking automatically which distribtions fits a data Jul 7, 2008
Hadley Wickham Method for checking automatically which distribtions fits a data Jul 7, 2008
David Reinke Method for checking automatically which distribtions fits a data Jul 7, 2008
Frank E Harrell Jr Method for checking automatically which distribtions fits a data Jul 7, 2008
L1 nonlinear approximation
3 msgs
Tine Mlac L1 nonlinear approximation Jul 3, 2008
Roger Koenker L1 nonlinear approximation Jul 3, 2008
Greg Snow L1 nonlinear approximation Jul 7, 2008
looking for alternative of 'if-else'
10 msgs
Arun Kumar Saha looking for alternative of 'if-else' Jul 6, 2008
Duncan Murdoch looking for alternative of 'if-else' Jul 6, 2008
ctu at bigred.unl.edu looking for alternative of 'if-else' Jul 6, 2008
Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008
Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008
Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008
Arun Kumar Saha looking for alternative of 'if-else' Jul 6, 2008
Duncan Murdoch looking for alternative of 'if-else' Jul 6, 2008
ctu at bigred.unl.edu looking for alternative of 'if-else' Jul 6, 2008
Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 7, 2008
Exception Handling
3 msgs
Tudor Bodea Exception Handling Jul 6, 2008
jim holtman Exception Handling Jul 7, 2008
Paul Gilbert Exception Handling Jul 7, 2008
A quick question about lm()
6 msgs
rlearner309 A quick question about lm() Jul 7, 2008
Henrique Dallazuanna A quick question about lm() Jul 7, 2008
(Ted Harding) A quick question about lm() Jul 7, 2008
Tobias Verbeke A quick question about lm() Jul 7, 2008
ONKELINX, Thierry A quick question about lm() Jul 7, 2008
(Ted Harding) A quick question about lm() Jul 7, 2008
Hi~problem with the two sample test: ks2Test in the package of fbasics
2 msgs
l y Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 6, 2008
Ben Bolker Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 7, 2008
Test for multiple comparisons: Nonlinear model, autocorrelation?
5 msgs
J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 4, 2008
Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 4, 2008
J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 5, 2008
Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 6, 2008
J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 7, 2008
cross-validation in rpart
1 msg
Terry Therneau cross-validation in rpart Jul 7, 2008
Sorting a list
3 msgs
tolga.i.uzuner at jpmorgan.com Sorting a list Jul 7, 2008
Peter Dalgaard Sorting a list Jul 7, 2008
milton ruser Sorting a list Jul 7, 2008
Bland-Altman method to measure agreement with repeated measures
3 msgs
kende jan Bland-Altman method to measure agreement with repeated measures Jul 5, 2008
Marc Schwartz Bland-Altman method to measure agreement with repeated measures Jul 5, 2008
Nutter, Benjamin Bland-Altman method to measure agreement with repeated measures Jul 7, 2008
Error in defining function
6 msgs
Megh Dal Error in defining function Jul 6, 2008
Gabor Grothendieck Error in defining function Jul 6, 2008
Megh Dal Error in defining function Jul 6, 2008
Gabor Grothendieck Error in defining function Jul 6, 2008
Megh Dal Error in defining function Jul 7, 2008
Gabor Grothendieck Error in defining function Jul 7, 2008
RES: Need ideas on how to show spikes in my data and how to codeit in R
1 msg
Thomas Frööjd RES: Need ideas on how to show spikes in my data and how to codeit in R Jul 7, 2008
Howto Initialize Parameter of Gamma Mixture Densities for EM
1 msg
Gundala Viswanath Howto Initialize Parameter of Gamma Mixture Densities for EM Jul 7, 2008
How can I optimize this piece of code ?
2 msgs
Daren Tan How can I optimize this piece of code ? Jul 7, 2008
ONKELINX, Thierry How can I optimize this piece of code ? Jul 7, 2008
How can i do an automatic upgrade of R 2.5.1 to R 2.7.1
8 msgs
Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008
Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008
Dirk Eddelbuettel How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008
Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008
Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008
Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008
Thibaut Jombart How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008
Paulo Cardoso spatial statistics and matrix algebra Jul 7, 2008
Hmisc latex: table column width
2 msgs
Lauri Nikkinen Hmisc latex: table column width Jul 4, 2008
Lauri Nikkinen Hmisc latex: table column width Jul 7, 2008
Plot Mixtures of Synthetically Generated Gamma Distributions
1 msg
Satoshi Takahama Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008
Plot Mixtures of Synthetically Generated Gamma Distributions
4 msgs
Gundala Viswanath Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008
Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008
Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008
Moshe Olshansky Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008
Backgrounds in Multiple Plots made with "fig"
2 msgs
Tom La Bone Backgrounds in Multiple Plots made with "fig" Jul 6, 2008
Paul Murrell Backgrounds in Multiple Plots made with "fig" Jul 6, 2008
Functional Data Analysis, fda_1.2.4
1 msg
Spencer Graves Functional Data Analysis, fda_1.2.4 Jul 6, 2008
Method for checking automatically which distribtions fits a data
2 msgs
Gundala Viswanath Method for checking automatically which distribtions fits a data Jul 6, 2008
ctu at bigred.unl.edu Method for checking automatically which distribtions fits a data Jul 6, 2008
Lots of huge matrices, for-loops, speed
6 msgs
Zarza Lots of huge matrices, for-loops, speed Jul 6, 2008
jim holtman Lots of huge matrices, for-loops, speed Jul 6, 2008
Ray Brownrigg Lots of huge matrices, for-loops, speed Jul 6, 2008
Moshe Olshansky Lots of huge matrices, for-loops, speed Jul 6, 2008
Rolf Turner Lots of huge matrices, for-loops, speed Jul 6, 2008
Moshe Olshansky Lots of huge matrices, for-loops, speed Jul 6, 2008
Regular expressions: bug or misunderstanding?
6 msgs
Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008
Gabor Grothendieck Regular expressions: bug or misunderstanding? Jul 6, 2008
(Ted Harding) Regular expressions: bug or misunderstanding? Jul 6, 2008
Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008
Gabor Grothendieck Regular expressions: bug or misunderstanding? Jul 6, 2008
Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008
Numbers as Points in Graphs
1 msg
Mark Leeds Numbers as Points in Graphs Jul 6, 2008
color with tcl/tk?
1 msg
Hua Li color with tcl/tk? Jul 6, 2008
Numbers as Points in Graphs
5 msgs
Sam Albers Numbers as Points in Graphs Jul 6, 2008
milton ruser Numbers as Points in Graphs Jul 6, 2008
Sam Albers Numbers as Points in Graphs Jul 6, 2008
(Ted Harding) Numbers as Points in Graphs Jul 6, 2008
Sam Albers Numbers as Points in Graphs Jul 6, 2008
ignore warning messages?
4 msgs
Hua Li ignore warning messages? Jul 1, 2008
Henrique Dallazuanna ignore warning messages? Jul 1, 2008
Jorge Ivan Velez ignore warning messages? Jul 1, 2008
Hua Li ignore warning messages? Jul 6, 2008
Numbers as Points in Graphs
2 msgs
Mark Leeds Numbers as Points in Graphs Jul 6, 2008
milton ruser Numbers as Points in Graphs Jul 6, 2008
What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments.
2 msgs
hpdutra What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Jul 6, 2008
Hadley Wickham What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Jul 6, 2008
Issue with postscript figures using WinAnsi encoding
1 msg
Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 6, 2008
ts.plot
2 msgs
threshold ts.plot Jul 6, 2008
Gabor Grothendieck ts.plot Jul 6, 2008
Benchmarking R and R Workloads
1 msg
Imanpreet Benchmarking R and R Workloads Jul 6, 2008
Hi~problem with the two sample test: ks2Test in the package of fbasics
1 msg
Lily Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 6, 2008
Windows Only: winMenuAdd() problem
2 msgs
Bert Gunter Windows Only: winMenuAdd() problem Jul 6, 2008
Duncan Murdoch Windows Only: winMenuAdd() problem Jul 6, 2008
Ignore blank columns when reading a row from a table
4 msgs
naw3 at duke.edu Ignore blank columns when reading a row from a table Jul 1, 2008
Erik Iverson Ignore blank columns when reading a row from a table Jul 1, 2008
Jorge Ivan Velez Ignore blank columns when reading a row from a table Jul 1, 2008
Bernardo Rangel Tura Ignore blank columns when reading a row from a table Jul 6, 2008
Repeated measures lme or anova
3 msgs
John Coulthard Repeated measures lme or anova Jul 4, 2008
Martin Henry H. Stevens Repeated measures lme or anova Jul 6, 2008
Hadley Wickham Repeated measures lme or anova Jul 6, 2008
Error: cannot use PQL when using lmer
4 msgs
hpdutra at yahoo.com Error: cannot use PQL when using lmer Jul 5, 2008
Ben Bolker Error: cannot use PQL when using lmer Jul 5, 2008
hpdutra Error: cannot use PQL when using lmer Jul 5, 2008
Martin Henry H. Stevens {spam?} Re: Error: cannot use PQL when using lmer Jul 6, 2008
lattice smooth problem?
2 msgs
Troels Ring lattice smooth problem? Jul 6, 2008
Gavin Simpson lattice smooth problem? Jul 6, 2008
help about random generation of a Normal distribution of several variables
5 msgs
Arnau Mir Torres help about random generation of a Normal distribution of several variables Jul 5, 2008
Peng Jiang help about random generation of a Normal distribution of several variables Jul 5, 2008
Bill Venables help about random generation of a Normal distribution ofseveral variables Jul 5, 2008
Bill Venables help about random generation of a Normal distribution ofseveral variables Jul 5, 2008
(Ted Harding) help about random generation of a Normal distribution of Jul 6, 2008
lattice question
2 msgs
Mark Leeds lattice question Jul 5, 2008
Felix Andrews lattice question Jul 6, 2008
Different Autocorrelation using R and other softwares
2 msgs
Yinny Different Autocorrelation using R and other softwares Jul 5, 2008
Brian Ripley Different Autocorrelation using R and other softwares Jul 6, 2008
interpreting mixed model anova results
2 msgs
Brooke LaFlamme interpreting mixed model anova results Jul 5, 2008
hpdutra interpreting mixed model anova results Jul 5, 2008
trying to superimpose a line plot onto a histogram
1 msg
Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008
trying to superimpose a line plot onto a histogram
1 msg
Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008
Error: cannot use PQL when using lmer
1 msg
hpdutra at yahoo.com Error: cannot use PQL when using lmer Jul 5, 2008
Problem solved: extracting values from a "by" function
1 msg
Daniel Stahl Problem solved: extracting values from a "by" function Jul 5, 2008
extracting values from a "by" function
1 msg
Daniel Stahl extracting values from a "by" function Jul 5, 2008
latex styling for R regression outputs
3 msgs
Matthias Bannert latex styling for R regression outputs Jul 3, 2008
Paul Hiemstra latex styling for R regression outputs Jul 3, 2008
Brian Lunergan using texmacs as front for R on windows xp sp2... Jul 5, 2008
trying to superimpose a line plot onto a histogram
3 msgs
Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008
milton ruser trying to superimpose a line plot onto a histogram Jul 5, 2008
Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008
SciViews GUI
2 msgs
Felipe Carrillo SciViews GUI Jul 5, 2008
Philippe GROSJEAN SciViews GUI Jul 5, 2008
help about random generation of a Normal distribution of several variables
4 msgs
Arnau Mir Torres help about random generation of a Normal distribution of several variables Jul 5, 2008
Peng Jiang help about random generation of a Normal distribution of several variables Jul 5, 2008
Gavin Simpson help about random generation of a Normal distribution of several variables Jul 5, 2008
(Ted Harding) help about random generation of a Normal distribution of Jul 5, 2008
set type of SS in anova()
3 msgs
Jeroen Ooms set type of SS in anova() Jul 4, 2008
Brian Ripley set type of SS in anova() Jul 5, 2008
John Fox set type of SS in anova() Jul 5, 2008
p-value for Nonmetric Multidimentional Scaling?
3 msgs
Michael Denslow p-value for Nonmetric Multidimentional Scaling? Jul 4, 2008
Bill Venables p-value for Nonmetric Multidimentional Scaling? Jul 4, 2008
Gavin Simpson p-value for Nonmetric Multidimentional Scaling? Jul 5, 2008
update search path for attached data
3 msgs
Ulrich Leopold update search path for attached data Jul 4, 2008
Brian Ripley update search path for attached data Jul 4, 2008
Ulrich Leopold update search path for attached data Jul 5, 2008
lattice smooth
1 msg
Troels Ring lattice smooth Jul 5, 2008
synthax for R CMD INSTALL
2 msgs
Naiara Pinto synthax for R CMD INSTALL Jul 4, 2008
Brian Ripley synthax for R CMD INSTALL Jul 5, 2008
logistic regreesion and score test
2 msgs
刘杰 logistic regreesion and score test Jul 4, 2008
Frank E Harrell Jr logistic regreesion and score test Jul 4, 2008
Calling and running a compiled program inside R
2 msgs
Paek, Insu Calling and running a compiled program inside R Jul 4, 2008
jim holtman Calling and running a compiled program inside R Jul 4, 2008
Error while plotting matrix
3 msgs
mysimbaa Error while plotting matrix Jul 4, 2008
Leandro Marino RES: Error while plotting matrix Jul 4, 2008
jim holtman create a zero matrix & fill Jul 4, 2008
RES: initialize a matrix
1 msg
Leandro Marino RES: initialize a matrix Jul 4, 2008
Re ad in a file - produce independent vectors
5 msgs
jimineep Re ad in a file - produce independent vectors Jul 4, 2008
Gabor Grothendieck Re ad in a file - produce independent vectors Jul 4, 2008
PIKAL Petr Odp: Re ad in a file - produce independent vectors Jul 4, 2008
Marc Schwartz Re ad in a file - produce independent vectors Jul 4, 2008
Brian Ripley Re ad in a file - produce independent vectors Jul 4, 2008
initialize a matrix
2 msgs
mysimbaa initialize a matrix Jul 4, 2008
mysimbaa initialize a matrix Jul 4, 2008
test for difference in variance
1 msg
Anders Malmendal test for difference in variance Jul 4, 2008
stop without error message
2 msgs
Eric Ferreira stop without error message Jul 4, 2008
Duncan Murdoch stop without error message Jul 4, 2008
Problem with strucchange package
4 msgs
tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 2, 2008
Achim Zeileis Problem with strucchange package Jul 2, 2008
tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 3, 2008
tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 4, 2008
problem with NA and if
5 msgs
Keld Jørn Simonsen problem with NA and if Jul 3, 2008
Andrew Robinson problem with NA and if Jul 3, 2008
Albert Greinoecker problem with NA and if Jul 3, 2008
Bill Venables problem with NA and if Jul 4, 2008
Keld J?rn Simonsen problem with NA and if Jul 4, 2008
passing arguments to a R script
1 msg
Daren Tan passing arguments to a R script Jul 4, 2008
Exporting a Graph that has lines()
4 msgs
R_Learner Exporting a Graph that has lines() Jul 3, 2008
Peter Dalgaard Exporting a Graph that has lines() Jul 3, 2008
R_Learner Exporting a Graph that has lines() Jul 3, 2008
Peter Dalgaard Exporting a Graph that has lines() Jul 4, 2008
kriging problem(?)
2 msgs
robert.ptacnik at niva.no kriging problem(?) Jul 4, 2008
Paul Hiemstra kriging problem(?) Jul 4, 2008
Problem in installing Biobase
2 msgs
Jason Lee Problem in installing Biobase Jul 4, 2008
Brian Ripley Problem in installing Biobase Jul 4, 2008
apply with a division
6 msgs
Greg Kettler apply with a division Jul 3, 2008
Henrique Dallazuanna apply with a division Jul 3, 2008
Marc Schwartz apply with a division Jul 3, 2008
Gabor Grothendieck apply with a division Jul 3, 2008
Abhijit Dasgupta apply with a division Jul 3, 2008
Gavin Simpson apply with a division Jul 4, 2008
Recoding
1 msg
Agustin Lobo Recoding Jul 3, 2008
by or tapply?
2 msgs
Michael Denslow by or tapply? Jul 3, 2008
jim holtman by or tapply? Jul 3, 2008
A regression problem using dummy variables
11 msgs
rlearner309 A regression problem using dummy variables Jul 1, 2008
Moshe Olshansky A regression problem using dummy variables Jul 1, 2008
rlearner309 A regression problem using dummy variables Jul 1, 2008
rlearner309 A regression problem using dummy variables Jul 2, 2008
Thomas Lumley A regression problem using dummy variables Jul 2, 2008
rlearner309 A regression problem using dummy variables Jul 2, 2008
Peter Dalgaard A regression problem using dummy variables Jul 3, 2008
Ron Michael A regression problem using dummy variables Jul 3, 2008
Bert Gunter A regression problem using dummy variables Jul 3, 2008
rlearner309 A regression problem using dummy variables Jul 3, 2008
Ron Michael A regression problem using dummy variables Jul 3, 2008
Tobit Estimation with Panel Data
2 msgs
Terry Therneau Tobit Estimation with Panel Data Jul 3, 2008
Arne Henningsen Tobit Estimation with Panel Data Jul 3, 2008
'as.Date' conversion of classes POSIX*t (problem/feature)?
2 msgs
Angel Spassov 'as.Date' conversion of classes POSIX*t (problem/feature)? Jul 3, 2008
Gabor Grothendieck 'as.Date' conversion of classes POSIX*t (problem/feature)? Jul 3, 2008
Ternaryplot function
2 msgs
theBenjamin Ternaryplot function Jul 3, 2008
Rolf Turner Ternaryplot function Jul 3, 2008
Installing R into home directory?
1 msg
Patrick Connolly Installing R into home directory? Jul 3, 2008
First attempt to use R
3 msgs
Ted First attempt to use R Jul 3, 2008
Roland Rau First attempt to use R Jul 3, 2008
Gabor Grothendieck First attempt to use R Jul 3, 2008
lines() warning message
4 msgs
Ranney, Steven lines() warning message Jul 3, 2008
Peter Dalgaard lines() warning message Jul 3, 2008
Ranney, Steven lines() warning message Jul 3, 2008
Peter Dalgaard lines() warning message Jul 3, 2008
For loop
1 msg
laila khalfan For loop Jul 3, 2008
subset function within a function
2 msgs
Lana Schaffer subset function within a function Jul 3, 2008
Henrique Dallazuanna subset function within a function Jul 3, 2008
Removing or overwriting an XML subtree
1 msg
Neumann, Steffen Removing or overwriting an XML subtree Jul 3, 2008
what can we do when R gives no response
1 msg
Carl Witthoft what can we do when R gives no response Jul 3, 2008
Installation of packages via GUI, Mac OS X
2 msgs
David Afshartous Installation of packages via GUI, Mac OS X Jul 3, 2008
Don MacQueen Installation of packages via GUI, Mac OS X Jul 3, 2008
Can't install package Matrix on solaris.
3 msgs
Scott Brown Can't install package Matrix on solaris. Jul 2, 2008
Brian Ripley Can't install package Matrix on solaris. Jul 3, 2008
Martin Maechler Can't install package Matrix on solaris. Jul 3, 2008
as.Date() clarification
4 msgs
Ron Michael as.Date() clarification Jul 3, 2008
Achim Zeileis as.Date() clarification Jul 3, 2008
Peter Dalgaard as.Date() clarification Jul 3, 2008
Martin Maechler as.Date() clarification Jul 3, 2008
Recoding a variable
5 msgs
Spencer Recoding a variable Jul 3, 2008
jim holtman Recoding a variable Jul 3, 2008
Stephan Kolassa Recoding a variable Jul 3, 2008
John Fox Recoding a variable Jul 3, 2008
Peter Dalgaard Recoding a variable Jul 3, 2008
Accessing a field in a data fram
6 msgs
R_Learner Accessing a field in a data fram Jul 2, 2008
jim holtman Accessing a field in a data fram Jul 2, 2008
Marc Schwartz Accessing a field in a data fram Jul 2, 2008
R_Learner Thanks! Jul 3, 2008
Marc Schwartz Thanks! Jul 3, 2008
R_Learner Thanks! Jul 3, 2008
For loop
1 msg
laila khalfan For loop Jul 3, 2008
Relative Mortality Risk second part
2 msgs
José Ignacio Bustos Melo Relative Mortality Risk second part Jul 3, 2008
Marc Schwartz Relative Mortality Risk second part Jul 3, 2008
problem with lm and predict - no predictions made
1 msg
Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 3, 2008
Sunset in Dortmund
7 msgs
Marc Schwartz Sunset in Dortmund Jul 2, 2008
Johannes Hüsing Sunset in Dortmund Jul 2, 2008
Marc Schwartz Sunset in Dortmund Jul 2, 2008
John Kane Sunset in Dortmund Jul 3, 2008
Marc Schwartz Sunset in Dortmund Jul 3, 2008
Uwe Ligges Sunset in Dortmund Jul 3, 2008
Johannes Hüsing Sunset in Dortmund Jul 3, 2008
*** significance with xtable
2 msgs
Bunny, lautloscrew.com *** significance with xtable Jul 3, 2008
Marc Schwartz *** significance with xtable Jul 3, 2008
Re membering the last time an event occurred within a dataframe
5 msgs
Jim Price Re membering the last time an event occurred within a dataframe Jul 3, 2008
Gabor Grothendieck Re membering the last time an event occurred within a dataframe Jul 3, 2008
Henrique Dallazuanna Re membering the last time an event occurred within a dataframe Jul 3, 2008
Jim Price Re membering the last time an event occurred within a dataframe Jul 3, 2008
Duncan Murdoch Re membering the last time an event occurred within a dataframe Jul 3, 2008
graph woes
2 msgs
Patrick Jackson graph woes Jul 3, 2008
Gabor Grothendieck graph woes Jul 3, 2008
R-help Digest, Vol 65, Issue 4
1 msg
José Ignacio Bustos Melo R-help Digest, Vol 65, Issue 4 Jul 3, 2008
R-help Digest, Vol 65, Issue 4
1 msg
José Ignacio Bustos Melo R-help Digest, Vol 65, Issue 4 Jul 3, 2008
For loop
1 msg
laila khalfan For loop Jul 3, 2008
Random effects and lme4
1 msg
wmh Random effects and lme4 Jul 3, 2008
Biostatistician Positions at Vanderbilt University
1 msg
Frank E Harrell Jr Biostatistician Positions at Vanderbilt University Jul 3, 2008
Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions
2 msgs
Vitalie S. Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions Jul 3, 2008
Deepayan Sarkar Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions Jul 3, 2008
position legend below x-axis title
3 msgs
Anne-Marie Ternes position legend below x-axis title Jul 2, 2008
Gabor Grothendieck position legend below x-axis title Jul 2, 2008
Greg Snow position legend below x-axis title Jul 3, 2008
Fitting a curve to data
5 msgs
Shirin Safa Fitting a curve to data Jul 1, 2008
stephen sefick Fitting a curve to data Jul 1, 2008
Shirin Safa Fitting a curve to data Jul 1, 2008
stephen sefick Fitting a curve to data Jul 1, 2008
Greg Snow Fitting a curve to data Jul 3, 2008
Reproducibility and GUIs
1 msg
Roger Koenker Reproducibility and GUIs Jul 3, 2008
read.table, NA assignment, and sep
2 msgs
Juliet Hannah read.table, NA assignment, and sep Jul 3, 2008
Peter Dalgaard read.table, NA assignment, and sep Jul 3, 2008
How to emulate perl style of reading files ?
3 msgs
Daren Tan How to emulate perl style of reading files ? Jul 3, 2008
Duncan Murdoch How to emulate perl style of reading files ? Jul 3, 2008
Brian Ripley How to emulate perl style of reading files ? Jul 3, 2008
ggplot2: scaling and tick mark of x-axis
2 msgs
Henning Wildhagen ggplot2: scaling and tick mark of x-axis Jul 3, 2008
Hadley Wickham ggplot2: scaling and tick mark of x-axis Jul 3, 2008
Usage of rJava (.jcall) with Weka functions, any example?
2 msgs
Josep Maria Campanera Alsina Usage of rJava (.jcall) with Weka functions, any example? Jul 2, 2008
Dumblauskas, Jerry Usage of rJava (.jcall) with Weka functions, any example? Jul 3, 2008
Data size
2 msgs
arghya ganguli Data size Jul 3, 2008
John Kane Data size Jul 3, 2008
cross-validation in rpart
1 msg
Sam Stewart cross-validation in rpart Jul 3, 2008
PCA on image data
1 msg
Monica Pisica PCA on image data Jul 3, 2008
auto.key in xyplot in conjunction with panel.text
3 msgs
David Afshartous auto.key in xyplot in conjunction with panel.text Jul 2, 2008
Deepayan Sarkar auto.key in xyplot in conjunction with panel.text Jul 2, 2008
David Afshartous auto.key in xyplot in conjunction with panel.text Jul 3, 2008
PCA on image data
5 msgs
Bio7 PCA on image data Jul 3, 2008
Jorge Ivan Velez PCA on image data Jul 3, 2008
Bio7 PCA on image data Jul 3, 2008
Jorge Ivan Velez PCA on image data Jul 3, 2008
Bio7 PCA on image data Jul 3, 2008
ggplot2 legend for vertical lines
2 msgs
Baptiste Auguie ggplot2 legend for vertical lines Jul 3, 2008
Hadley Wickham ggplot2 legend for vertical lines Jul 3, 2008
How do I paste double quotes arround a character string?
11 msgs
Phil Smith How do I paste double quotes arround a character string? Jul 2, 2008
Erik Iverson How do I paste double quotes arround a character string? Jul 2, 2008
(Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008
Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008
(Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008
Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008
Phil Smith correction to small typo: How do I paste double quotes arround a character string? Jul 3, 2008
Brian Ripley How do I paste double quotes arround a character string? Jul 3, 2008
(Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008
Brian Ripley How do I paste double quotes arround a character string? Jul 3, 2008
Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008
combining time series [was: (no subject)]
2 msgs
Gabor Grothendieck combining time series [was: (no subject)] Jul 3, 2008
Gabor Grothendieck combining time series [was: (no subject)] Jul 3, 2008
how to automatically maximize the graph window (under XP) ?
4 msgs
Ptit_Bleu how to automatically maximize the graph window (under XP) ? Jul 1, 2008
Leandro Marino RES: how to automatically maximize the graph window (under XP) ? Jul 1, 2008
Ptit_Bleu how to automatically maximize the graph window (under XP) ? Jul 3, 2008
Brian Ripley how to automatically maximize the graph window (under XP) ? Jul 3, 2008
Prediction with Bayesian Network?
2 msgs
stephanos Prediction with Bayesian Network? Jul 1, 2008
Marco Scutari Prediction with Bayesian Network? Jul 3, 2008
problem with lm and predict - no predictions made
5 msgs
Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 2, 2008
Erik Iverson problem with lm and predict - no predictions made Jul 2, 2008
Jorge Ivan Velez problem with lm and predict - no predictions made Jul 2, 2008
Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 3, 2008
PIKAL Petr problem with lm and predict - no predictions made Jul 3, 2008
loop calculation
1 msg
Ben Bolker loop calculation Jul 3, 2008
what can we do when R gives no response
4 msgs
Peng Jiang what can we do when R gives no response Jul 2, 2008
jim holtman what can we do when R gives no response Jul 2, 2008
Peng Jiang what can we do when R gives no response Jul 2, 2008
jim holtman what can we do when R gives no response Jul 3, 2008
Problem with loading library-ks
3 msgs
Mayukh Dass Problem with loading library-ks Jul 1, 2008
Uwe Ligges Problem with loading library-ks Jul 2, 2008
Brian Ripley Problem with loading library-ks Jul 3, 2008
Orthogonal polynomials and poly
2 msgs
giovanni parrinello Orthogonal polynomials and poly Jul 1, 2008
Brian Ripley Orthogonal polynomials and poly Jul 3, 2008
Problem in applying conditional looping
2 msgs
Nadeem Shafique Problem in applying conditional looping Jul 3, 2008
jim holtman Problem in applying conditional looping Jul 3, 2008
survival package test stats
1 msg
Terry Therneau survival package test stats Jul 3, 2008
select.list() cannot be used non-interactively
2 msgs
Fabio Fanoni select.list() cannot be used non-interactively Jul 1, 2008
Brian Ripley select.list() cannot be used non-interactively Jul 3, 2008
Akaike or BIC criteria for feed-forward neural nets
1 msg
Brian Ripley Akaike or BIC criteria for feed-forward neural nets Jul 3, 2008
randomForest.error: length of response must be the same as predictors
3 msgs
Soumyadeep Nandi randomForest.error: length of response must be the same as predictors Jul 2, 2008
Gavin Simpson randomForest.error: length of response must be the same as predictors Jul 3, 2008
Soumyadeep Nandi randomForest.error: length of response must be the same as predictors Jul 3, 2008
Installation 2.7.1 [requires Perl >= 5.8.0]
1 msg
Brian Ripley Installation 2.7.1 [requires Perl >= 5.8.0] Jul 3, 2008
Using ODBC/RODBC with DBI
1 msg
Brian Ripley Using ODBC/RODBC with DBI Jul 3, 2008
Matrix set value problem
3 msgs
Valentino Botta Matrix set value problem Jul 3, 2008
ONKELINX, Thierry Matrix set value problem Jul 3, 2008
ctu at bigred.unl.edu Matrix set value problem Jul 3, 2008
dgamma in WinBUGS and JAGS (rjags)
1 msg
Seyed Reza Jafarzadeh dgamma in WinBUGS and JAGS (rjags) Jul 3, 2008
help appreciated to make a plot
3 msgs
Zheng Lu help appreciated to make a plot Jul 2, 2008
Gabor Grothendieck help appreciated to make a plot Jul 2, 2008
Jim Lemon help appreciated to make a plot Jul 3, 2008
get formatted regression output
3 msgs
Bunny, lautloscrew.com get formatted regression output Jul 2, 2008
Abhijit Dasgupta get formatted regression output Jul 2, 2008
Jim Lemon get formatted regression output Jul 3, 2008
Otpmial initial centroid in kmeans
2 msgs
Chua Siang Li Otpmial initial centroid in kmeans Jul 2, 2008
Gavin Simpson Otpmial initial centroid in kmeans Jul 3, 2008
RODBC Access limit?
2 msgs
HBaize RODBC Access limit? Jul 3, 2008
ONKELINX, Thierry RODBC Access limit? Jul 3, 2008
Migrating from S-Plus to R - Exporting Tables
2 msgs
jim holtman Migrating from S-Plus to R - Exporting Tables Jul 2, 2008
Gustaf Rydevik Migrating from S-Plus to R - Exporting Tables Jul 3, 2008
(no subject)
1 msg
Silika Prohl (no subject) Jul 3, 2008
post hoc comparisons on NLME for longitudinal data
1 msg
Humberto Dutra post hoc comparisons on NLME for longitudinal data Jul 3, 2008
Plotting Prediction Surface with persp()
1 msg
Rory Winston Plotting Prediction Surface with persp() Jul 3, 2008
set values in data.frame to NA conditional on another data.frame
2 msgs
Carson Farmer set values in data.frame to NA conditional on another data.frame Jul 2, 2008
PIKAL Petr Odp: set values in data.frame to NA conditional on another data.frame Jul 3, 2008
playwith package does not work on Ubuntu?
1 msg
Felix Andrews playwith package does not work on Ubuntu? Jul 2, 2008
NLME questions -- interpretation of results
4 msgs
Jenny Sun NLME questions -- interpretation of results Jul 2, 2008
ctu at bigred.unl.edu NLME questions -- interpretation of results Jul 2, 2008
Jenny Sun NLME questions -- interpretation of results Jul 2, 2008
ctu at bigred.unl.edu NLME questions -- interpretation of results Jul 2, 2008
Plotting Prediction Surface with persp()
2 msgs
Rory Winston Plotting Prediction Surface with persp() Jul 2, 2008
Duncan Murdoch Plotting Prediction Surface with persp() Jul 2, 2008
Processing 10^8 rows and 1^3 columns
2 msgs
Daren Tan Processing 10^8 rows and 1^3 columns Jul 2, 2008
Gabor Grothendieck Processing 10^8 rows and 1^3 columns Jul 2, 2008
how to capture matching words in a string ?
2 msgs
Daren Tan how to capture matching words in a string ? Jul 2, 2008
Gabor Grothendieck how to capture matching words in a string ? Jul 2, 2008
neural networks
1 msg
Donna Tucker neural networks Jul 2, 2008
plot.zoo labels
5 msgs
Ryan Sheftel plot.zoo labels Jul 1, 2008
stephen sefick plot.zoo labels Jul 1, 2008
Gabor Grothendieck plot.zoo labels Jul 1, 2008
Ryan Sheftel plot.zoo labels Jul 2, 2008
Gabor Grothendieck plot.zoo labels Jul 2, 2008
flow map lines between point pairs (latitude/longitude)
3 msgs
Richard and Barbara Males flow map lines between point pairs (latitude/longitude) Jul 2, 2008
Ray Brownrigg flow map lines between point pairs (latitude/longitude) Jul 2, 2008
Richard and Barbara Males flow map lines between point pairs (latitude/longitude) Jul 2, 2008
help on list comparison
2 msgs
Rajasekaramya help on list comparison Jul 2, 2008
Jorge Ivan Velez help on list comparison Jul 2, 2008
Removing or overwriting an XML node
1 msg
Neumann, Steffen Removing or overwriting an XML node Jul 2, 2008
Insert text in data.frame
2 msgs
Mafalda Viana Insert text in data.frame Jul 2, 2008
jim holtman Insert text in data.frame Jul 2, 2008
Reading CSV file with unequal record length
3 msgs
Viswanathan Shankar Reading CSV file with unequal record length Jul 2, 2008
Marc Schwartz Reading CSV file with unequal record length Jul 2, 2008
Peter Dalgaard Reading CSV file with unequal record length Jul 2, 2008
conversion of data for use within barchart
2 msgs
Karin Lagesen conversion of data for use within barchart Jul 2, 2008
Deepayan Sarkar conversion of data for use within barchart Jul 2, 2008
heatmap
2 msgs
Nair, Murlidharan T heatmap Jul 2, 2008
Nair, Murlidharan T heatmap Jul 2, 2008
exporting ftable
2 msgs
Leandro Marino exporting ftable Jul 2, 2008
Henrique Dallazuanna exporting ftable Jul 2, 2008
Multiple time series plots
4 msgs
Kerpel, John Multiple time series plots Jul 2, 2008
stephen sefick Multiple time series plots Jul 2, 2008
Kerpel, John Multiple time series plots Jul 2, 2008
Gabor Grothendieck Multiple time series plots Jul 2, 2008
graph woes
1 msg
Patrick Jackson graph woes Jul 2, 2008
Goodness of fit test
1 msg
martin.gaston at unavarra.es Goodness of fit test Jul 2, 2008
question on dispersion parameter
1 msg
jpl question on dispersion parameter Jul 2, 2008
error on predict
1 msg
Michele Santacatterina error on predict Jul 2, 2008
Problem reading from a data frame
4 msgs
naw3 at duke.edu Problem reading from a data frame Jul 2, 2008
Jorge Ivan Velez Problem reading from a data frame Jul 2, 2008
jim holtman Problem reading from a data frame Jul 2, 2008
Marc Schwartz Problem reading from a data frame Jul 2, 2008
Hmisc latex function with longtable option
2 msgs
Erik Iverson Hmisc latex function with longtable option Jul 2, 2008
Frank E Harrell Jr Hmisc latex function with longtable option Jul 2, 2008
Plotting Bi-Gamma Distribution
4 msgs
Gundala Viswanath Plotting Bi-Gamma Distribution Jul 1, 2008
Ben Bolker Plotting Bi-Gamma Distribution Jul 2, 2008
Gundala Viswanath Plotting Bi-Gamma Distribution Jul 2, 2008
Wolfgang Raffelsberger Plotting Bi-Gamma Distribution Jul 2, 2008
Extracting regression coef. and p-values in JRClient
1 msg
Amine Mohamed ROUANE HACENE Extracting regression coef. and p-values in JRClient Jul 2, 2008
Extracting regression coef. and p-values in JRClient
1 msg
Amine Mohamed ROUANE HACENE Extracting regression coef. and p-values in JRClient Jul 2, 2008
Optimal lag selection in Granger Causality tests
2 msgs
Matthieu Stigler Optimal lag selection in Granger Causality tests Jul 2, 2008
tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008
passing a variable at the command line
5 msgs
Erin Hodgess passing a variable at the command line Jul 1, 2008
Sébastien Bihorel passing a variable at the command line Jul 1, 2008
Marc Schwartz passing a variable at the command line Jul 1, 2008
Dirk Eddelbuettel passing a variable at the command line Jul 1, 2008
Luke Tierney passing a variable at the command line Jul 2, 2008
log plots woes
1 msg
Patrick Jackson log plots woes Jul 2, 2008
Zoo plotting behavior
10 msgs
stephen sefick Zoo plotting behavior Jul 2, 2008
stephen sefick Zoo plotting behavior Jul 2, 2008
stephen sefick Zoo plotting behavior Jul 2, 2008
Gabor Grothendieck Zoo plotting behavior Jul 2, 2008
stephen sefick Zoo plotting behavior Jul 2, 2008
Gabor Grothendieck Zoo plotting behavior Jul 2, 2008
Gabor Grothendieck Zoo plotting behavior Jul 2, 2008
stephen sefick Zoo plotting behavior Jul 2, 2008
Gabor Grothendieck Zoo plotting behavior Jul 2, 2008
Gabor Grothendieck Zoo plotting behavior Jul 2, 2008
Tobit Estimation with Panel Data
1 msg
Arne Henningsen Tobit Estimation with Panel Data Jul 2, 2008
RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries)
3 msgs
Kurapati, Ravichandra (Ravichandra) RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008
PIKAL Petr Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008
Kathi Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008
variable as part of file name
5 msgs
Laura Poggio variable as part of file name Jul 2, 2008
Henrique Dallazuanna variable as part of file name Jul 2, 2008
Richard Pearson variable as part of file name Jul 2, 2008
Laura Poggio variable as part of file name Jul 2, 2008
Hans-Jörg Bibiko variable as part of file name Jul 2, 2008
randomForest training error
2 msgs
Soumyadeep Nandi randomForest training error Jul 2, 2008
Leandro Marino Migrating from S-Plus to R - Exporting Tables Jul 2, 2008
survival package test stats
1 msg
Geoffrey Smith survival package test stats Jul 2, 2008
Correlation structures in gls with repeated measurements
3 msgs
t03eh7 at abdn.ac.uk Correlation structures in gls with repeated measurements Jul 2, 2008
ONKELINX, Thierry Correlation structures in gls with repeated measurements Jul 2, 2008
t03eh7 at abdn.ac.uk Correlation structures in gls with repeated measurements Jul 2, 2008
bug in axis.Date? was (Re: newbie needs help plotting time series)
3 msgs
PIKAL Petr bug in axis.Date? was (Re: newbie needs help plotting time series) Jul 2, 2008
Leandro Marino RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries) Jul 2, 2008
PIKAL Petr Odp: RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries) Jul 2, 2008
Question about GCL function
1 msg
Peter Flom Question about GCL function Jul 2, 2008
dev.off() inside a function & other glitches
5 msgs
Michael Hopkins dev.off() inside a function & other glitches Jul 1, 2008
Duncan Murdoch dev.off() inside a function & other glitches Jul 1, 2008
Deepayan Sarkar dev.off() inside a function & other glitches Jul 1, 2008
jim holtman dev.off() inside a function & other glitches Jul 1, 2008
Michael Hopkins dev.off() inside a function & other glitches Jul 2, 2008
WIERD: Basic computing in R
13 msgs
poolloopus at yahoo.com WIERD: Basic computing in R Jul 1, 2008
Dirk Eddelbuettel WIERD: Basic computing in R Jul 1, 2008
Mark Lyman WIERD: Basic computing in R Jul 1, 2008
Marc Schwartz WIERD: Basic computing in R Jul 1, 2008
Leandro Marino RES: WIERD: Basic computing in R Jul 1, 2008
Thomas Lumley WIERD: Basic computing in R Jul 1, 2008
Bert Gunter W-E-I-R-D Weird! Jul 1, 2008
Rolf Turner W-E-I-R-D Weird! Jul 1, 2008
Bert Gunter W-E-I-R-D Weird! Jul 1, 2008
Rolf Turner W-E-I-R-D Weird! Jul 1, 2008
Jim Lemon W-E-I-R-D Weird! Jul 2, 2008
Thomas Adams W-E-I-R-D Weird! Jul 2, 2008
Thomas Adams W-E-I-R-D Weird! Jul 2, 2008
Help in using PCR
9 msgs
Jason Lee Help in using PCR Jun 30, 2008
Gavin Simpson Help in using PCR Jul 1, 2008
Bjørn-Helge Mevik Help in using PCR Jul 1, 2008
Jason Lee Help in using PCR Jul 1, 2008
Erik Iverson Help in using PCR Jul 1, 2008
Gavin Simpson Help in using PCR Jul 1, 2008
Bjørn-Helge Mevik Help in using PCR Jul 2, 2008
Gavin Simpson Help in using PCR Jul 2, 2008
Bjørn-Helge Mevik Help in using PCR Jul 2, 2008
Sweave / Latex per-chapter output
1 msg
Anne-Marie Ternes Sweave / Latex per-chapter output Jul 2, 2008
Combining playwith with par(mfrow... ) i.e., multiple plots.
1 msg
Vorlow Constantinos Combining playwith with par(mfrow... ) i.e., multiple plots. Jul 2, 2008
Optimal lag selection in Granger Causality tests
3 msgs
tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008
ONKELINX, Thierry Optimal lag selection in Granger Causality tests Jul 2, 2008
tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008
Area Under a Curve
3 msgs
stephen sefick Area Under a Curve Jul 1, 2008
Rolf Turner Area Under a Curve Jul 1, 2008
Bart Joosen Area Under a Curve Jul 2, 2008
Fitting a curve to data
5 msgs
Carl Witthoft Fitting a curve to data Jul 1, 2008
stephen sefick Fitting a curve to data Jul 1, 2008
Gabor Grothendieck Fitting a curve to data Jul 1, 2008
Carl Witthoft Fitting a curve to data Jul 1, 2008
Vikas Rawal Fitting a curve to data Jul 1, 2008
Install Packages in Windows Vista
3 msgs
nicholasw22 Install Packages in Windows Vista Jul 1, 2008
Charles Annis, P.E. Install Packages in Windows Vista Jul 1, 2008
Gabor Grothendieck Install Packages in Windows Vista Jul 1, 2008
Problems with lm()
1 msg
Hsin-Ya Lee Problems with lm() Jul 1, 2008
Survival Analysis questions
1 msg
Viet Le Survival Analysis questions Jul 1, 2008
is there an equivalent of prop.table but for counts
3 msgs
Mark Leeds is there an equivalent of prop.table but for counts Jul 1, 2008
Jorge Ivan Velez is there an equivalent of prop.table but for counts Jul 1, 2008
Jorge Ivan Velez is there an equivalent of prop.table but for counts Jul 1, 2008
forget my previous question
1 msg
Mark Leeds forget my previous question Jul 1, 2008
PCA : Error in eigen(cv,
2 msgs
Tanya Yatsunenko PCA : Error in eigen(cv, Jul 1, 2008
Daniel Malter PCA : Error in eigen(cv, Jul 1, 2008
problem with mpiexec and Rmpi
4 msgs
Erin Hodgess problem with mpiexec and Rmpi Jul 1, 2008
Martin Morgan problem with mpiexec and Rmpi Jul 1, 2008
Dirk Eddelbuettel problem with mpiexec and Rmpi Jul 1, 2008
Dirk Eddelbuettel problem with mpiexec and Rmpi Jul 1, 2008
if one of 4 conditions is not satisfied
4 msgs
mysimbaa if one of 4 conditions is not satisfied Jul 1, 2008
Marc Schwartz if one of 4 conditions is not satisfied Jul 1, 2008
mysimbaa if one of 4 conditions is not satisfied Jul 1, 2008
Peng Jiang if one of 4 conditions is not satisfied Jul 1, 2008
adding a package in Windows
2 msgs
Lana Schaffer adding a package in Windows Jul 1, 2008
Duncan Murdoch adding a package in Windows Jul 1, 2008
how to estimate the parameters in a bivariate weibull distribution?
1 msg
程燕 how to estimate the parameters in a bivariate weibull distribution? Jul 1, 2008
Graph Order in xyplot
4 msgs
Sam Albers Graph Order in xyplot Jul 1, 2008
Gabor Grothendieck Graph Order in xyplot Jul 1, 2008
Deepayan Sarkar Graph Order in xyplot Jul 1, 2008
Sam Albers Graph Order in xyplot Jul 1, 2008
Simulate from a GAM model
2 msgs
Mark Lyman Simulate from a GAM model Jul 1, 2008
Gavin Simpson Simulate from a GAM model Jul 1, 2008
Change name of a specific column of a data frame
4 msgs
naw3 at duke.edu Change name of a specific column of a data frame Jul 1, 2008
jim holtman Change name of a specific column of a data frame Jul 1, 2008
Philip Twumasi-Ankrah Change name of a specific column of a data frame Jul 1, 2008
Leandro Marino RES: Change name of a specific column of a data frame Jul 1, 2008
plot window
4 msgs
Henrique Dallazuanna plot window Jul 1, 2008 Leandro Marino plot window Jul 1, 2008
Gabor Grothendieck plot window Jul 1, 2008
Leandro Marino RES: plot window Jul 1, 2008
Problem reading a CSV
1 msg
Jim Porzak Problem reading a CSV Jul 1, 2008
"Invalid object" error in boxplot
3 msgs
mm745 at st-andrews.ac.uk "Invalid object" error in boxplot Jul 1, 2008
Erik Iverson "Invalid object" error in boxplot Jul 1, 2008
Leandro Marino RES: "Invalid object" error in boxplot Jul 1, 2008
reshape matrices
2 msgs
Francisco Javier Santos Alamillos reshape matrices Jul 1, 2008
Marc Schwartz reshape matrices Jul 1, 2008
Set default value
2 msgs
Marco Salvi Set default value Jul 1, 2008
Erik Iverson Set default value Jul 1, 2008
Set default value
4 msgs
Michela Cameletti Set default value Jul 1, 2008
Gunther Höning Regression and fitting Jul 1, 2008
ONKELINX, Thierry Regression and fitting Jul 1, 2008
Gunther Höning Regression and fitting Jul 1, 2008
Query on packages for Emerging Patterns
1 msg
Jason Lee Query on packages for Emerging Patterns Jul 1, 2008
Problem reading a CSV
1 msg
Paulo Barata Problem reading a CSV Jul 1, 2008
Messge ``no visible binding''.
2 msgs
Rolf Turner Messge ``no visible binding''. Jun 30, 2008
Gregory R. Warnes Messge ``no visible binding''. Jul 1, 2008
trivial list question
6 msgs
Boks, M.P.M. trivial list question Jul 1, 2008
Gábor Csárdi trivial list question Jul 1, 2008
ONKELINX, Thierry trivial list question Jul 1, 2008
Henrique Dallazuanna trivial list question Jul 1, 2008
Kenn Konstabel trivial list question Jul 1, 2008
Wacek Kusnierczyk trivial list question Jul 1, 2008
Find classes of each column of data.frame()
5 msgs
Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008
Henrique Dallazuanna Find classes of each column of data.frame() Jul 1, 2008
Gábor Csárdi Find classes of each column of data.frame() Jul 1, 2008
Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008
Wacek Kusnierczyk Find classes of each column of data.frame() Jul 1, 2008
Find classes of each column of data.frame()
1 msg
Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008
adtest for weibull distribution
1 msg
René Pineda adtest for weibull distribution Jul 1, 2008
cohort sampling
1 msg
Terry Therneau cohort sampling Jul 1, 2008
lm and NA
1 msg
Kenn Konstabel lm and NA Jul 1, 2008
Add comments on plot window
1 msg
Gabor Grothendieck Add comments on plot window Jul 1, 2008
Add comments on plot window
1 msg
mysimbaa Add comments on plot window Jul 1, 2008
Odp: newbie needs help plotting time series
1 msg
PIKAL Petr Odp: newbie needs help plotting time series Jul 1, 2008
Add comments on plot window
1 msg
Jim Lemon Add comments on plot window Jul 1, 2008
Which distribution best fits the data?
1 msg
Matthieu Stigler Which distribution best fits the data? Jul 1, 2008
Help on Analysis of covariance
2 msgs
Partha Help on Analysis of covariance Jul 1, 2008
Chuck Cleland Help on Analysis of covariance Jul 1, 2008
reshape matrices
2 msgs
Francisco Javier Santos Alamillos reshape matrices Jul 1, 2008
jim holtman reshape matrices Jul 1, 2008
Installing R into home directory?
1 msg
Steve Cadman Installing R into home directory? Jul 1, 2008
Are centre coordinates or upper left corners used of x, y for SpatialPixels?
3 msgs
Jan.Verbesselt at csiro.au Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008
Paul Hiemstra Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008
Paul Hiemstra Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008
extracting elements from a list in vectorized form
3 msgs
Javier Garcia-Pintado extracting elements from a list in vectorized form Jul 1, 2008
Peter Dalgaard extracting elements from a list in vectorized form Jul 1, 2008
Javier Garcia-Pintado extracting elements from a list in vectorized form Jul 1, 2008
PCA : Error in eigen(cv,
2 msgs
Mclust ???
1 msg
Peng Jiang Mclust ??? Jun 30, 2008
Coda not providing summary on mcmc object
1 msg
Ben Bolker Coda not providing summary on mcmc object Jun 30, 2008