R-help - July 2008 - Date View

Thursday, July 31, 2008 114 emails

Ferry Remove Even Number from A Vector Moshe Olshansky cutting out numbers from vectors Paul Roebuck cutting out numbers from vectors Moshe Olshansky Grouping Index of Matrix Based on Certain Condition Moshe Olshansky cutting out numbers from vectors Marc Schwartz Help with hazard plots Jorge Ivan Velez Grouping Index of Matrix Based on Certain Condition Christos Hatzis Grouping Index of Matrix Based on Certain Condition Satoshi Takahama Storing Matrices into Hash Ted Rosenbaum Problem with RSPython Moshe Olshansky Code to calculate internal rate of return stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Bert Gunter Storing Matrices into Hash stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Erik Iverson Storing Matrices into Hash jim holtman Coarsening the Resolution of a Dataset Erik Iverson Storing Matrices into Hash g-h-d How to abort JGR Steven McKinney sort rows of matrix by rows of another matrix Bruno P Masi P-I curve Michael clustering and data-mining... Vadim Kutsyy allocMatrix limits Agus Susanto multiple comparison Mark Leeds sort rows of matrix by rows of another matrix Deepayan Sarkar bwplot with Date object Duncan Murdoch dput vs unclass to see what a factor really is composed of Johnson, Eric A. (Seattle) sort rows of matrix by rows of another matrix Duncan Murdoch instal tar.gz package on windows Brian Ripley dput vs unclass to see what a factor really is composed of Brian Ripley allocMatrix limits Alan Cox Help with hazard plots Alan Cox Help with hazard plots Stefan Evert instal tar.gz package on windows Alessandro anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Jacob Wegelin dput vs unclass to see what a factor really is composed of Gabor Grothendieck rollapply() to portions of a matrix Vadim Kutsyy allocMatrix limits Timothy W. Hilton sort rows of matrix by rows of another matrix Jeffrey Horner 'system' command through Rserve Marc Schwartz instal tar.gz package on windows Deepayan Sarkar strip names lattice graphics Hadley Wickham History pruning Steve Murray Coarsening the Resolution of a Dataset Marc Schwartz Randomly drawing observations from factors. calundergrad cutting out numbers from vectors Gabor Grothendieck upgrade to 2.5 GOUACHE David strip names lattice graphics Economics Guy Randomly drawing observations from factors. georgiana onicescu instal tar.gz package on windows Sundar Dorai-Raj upgrade to 2.5 GOUACHE David vertical bpplot Stefan Grosse Query about finding correlations GOUACHE David bwplot with Date object Patil, Prasad 'system' command through Rserve Ken Williams History pruning rcoder rollapply() to portions of a matrix Peter Dalgaard reference in article Duncan Murdoch History pruning Aiste Aistike How to output R image to a file? Max Random number generation Erik Iverson How to output R image to a file? Aiste Aistike How to output R image to a file? rcoder Re gression between adjacent columns - error with NAs Alessandro anisotrophy in fit.variogram problem Ken Williams History pruning Max Random number generation Patrizio Frederic Random number generation Jorge Ivan Velez Random number generation Zhang Yanwei - Princeton-MRAm Sampling two exponentials Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Marc Schwartz Random number generation David Barron Random number generation Max Random number generation Christos Hatzis Identifying common prefixes from a vector of words, and delete those prefixes Gregoire Pau hwriter - Writing R objects in HTML format Mark Difford Coefficients of Logistic Regression from bootstrap - how to get them? John Kane Identifying common prefixes from a vector of words, and delete those prefixes Roger Bivand question about krige code in R Birgitle Sperman Correlation with rcorr (Hmisc) Thomas E Code to calculate internal rate of return Marc Schwartz History pruning FScottDahlgren Create an R package Marc Schwartz odds ratios in multiway tables (stratified) Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Iasonas Lamprianou stats question Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jia Ying Mei Rearranging Data Gundala Viswanath Identifying Points That Belongs to Components of Mixture Models Ben Bolker Converting to subscripts and superscripts bbouling Significance of confidence intervals in the Non-Linear Least Squares Program. Ken Williams History pruning Liaw, Andy equivalent R functions for Numerical Recipes fitxy and fitexy ? Richard Cotton Identifying common prefixes from a vector of words, and delete those prefixes Brian Ripley nls weights warning message Ben Bolker Sampling two exponentials Brian Ripley nls weights warning message Marc Schwartz stats question mfrumin bug in 'margins' behavior in reshape - cast Zhang Yanwei - Princeton-MRAm Sampling two exponentials Hadley Wickham bug in 'margins' behavior in reshape - cast Wim Bertels odds ratios in multiway tables (stratified) Lisa Readdy nls weights warning message ONKELINX, Thierry combinations with replications Keith Ponting Location of HTML help files Jim Lemon combinations with replications Daren Tan Identifying common prefixes from a vector of words, and delete those prefixes ajay ohri OT:Selling Data Mining Cloud-A Concept Michael Frumin bug in 'margins' behavior in reshape - cast Fensis random effects mixed model, different regressors MarinaTarantini combinations with replications john seers (IFR) add string Alfredo Alessandrini add string Moshe Olshansky stats question

Wednesday, July 30, 2008 154 emails

Brian Ripley multiple separators in scan() functions Brian Ripley High resolution graphics from R Windows Vista Brian Ripley predict rpart: new data has new level Iasonas Lamprianou stats question Adam Langley High resolution graphics from R Windows Vista Beat Huggler Generic plot function for GLM objects Jia Ying Mei Rearranging Data milton ruser multiple separators in scan() functions Chua Siang Li predict rpart: new data has new level Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Erik Iverson colnames from read.table stephen sefick S 3 generic method consistency warning please help stephen sefick S 3 generic method consistency warning please help Gabor Grothendieck S 3 generic method consistency warning please help stephen sefick S 3 generic method consistency warning please help Chua Siang Li colnames from read.table Moshe Olshansky Sampling two exponentials Gabor Grothendieck Re gression between adjacent columns - error with NAs Adam Langley High resolution graphics from Windows Vista Krzysztof Sakrejda Re gression between adjacent columns - error with NAs Bruno P Masi curva PI Ben Bolker Sampling two exponentials Paul.Rustomji at csiro.au Is conditional evaluation of R code chunks possible in Sweave ? Bill Venables barplot for a categorial variable Deepayan Sarkar Unexpected line type in lattice plot key on pdf device Deepayan Sarkar Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Rolf Turner dotFirst option Ferry dotFirst option Alessandro question about krige code in R kayj barplot for a categorial variable stephen sefick john chambers R book rcoder Re gression between adjacent columns - error with NAs Zhang Yanwei - Princeton-MRAm Sampling two exponentials Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Rolf Turner FFT - (STATS) - is this correct? nmarti Rprintf will not build in my C++ compiler Marc Schwartz john chambers R book Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Christos Hatzis john chambers R book naw3 at duke.edu Converting to subscripts and superscripts Ranjan Bagchi System exit codes Martin Morgan read XML Brian Ripley System exit codes Gavin Simpson Re creating Procrustes Plot in Lattice Jay Douillard Setting fixed size for segement plot using stars() (axes size vs print size) Gabor Grothendieck rolling regression between adjacent columns Marc Schwartz History pruning Roland Rau Random subset Erik Iverson Variable name in a String Brian Ripley setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Ranjan Bagchi System exit codes Marc Schwartz Random subset Marc Schwartz Random subset Mark Leeds john chambers R book Ranjan Bagchi System exit codes Roland Rau Random subset John Kane Random subset Alessandro Random subset Ken Williams History pruning Hadley Wickham bug in 'margins' behavior in reshape - cast rcoder rolling regression between adjacent columns Marc Schwartz setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile rcoder Re gression between columns in matrix - with some/full NAs Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Vincent Goulet best quad core configuration? pacomet About clustering techniques mfrumin bug in 'margins' behavior in reshape - cast Dylan Beaudette Re creating Procrustes Plot in Lattice R_Learner Variable name in a String Mark Difford Mixed effects model where nested factor is not the repeated across treatments lme??? Marc Schwartz odds ratios in multiway tables (stratified) Alan Swanson best quad core configuration? Hadley Wickham bug in 'margins' behavior in reshape - cast Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Kiran Annaiah Hello, mfrumin bug in 'margins' behavior in reshape - cast ajay ohri OT: Data mining on demand .Using cloud computers. Michael Dewey ~ . help Gavin Simpson Re creating Procrustes Plot in Lattice Gábor Csárdi R -Legality Question about R's Open Source GNU GPL Licen renata.camargo05 at ntlworld.com FOURIER TRANSFORM HELP ajay ohri R -Legality Question about R's Open Source GNU GPL License (Ted Harding) R -Legality Question about R's Open Source GNU GPL Licen Brian Ripley Rprintf will not build in my C++ compiler David Afshartous Axes in perspective plot - persp() Marc Schwartz R -Legality Question about R's Open Source GNU GPL License ctu at bigred.unl.edu Mixed effects model where nested factor is not the repeated across treatments lme??? ajay ohri R -Legality Question about R's Open Source GNU GPL License Jia Ying Mei Percent Change After Each Interval Ben Bolker adding lines to multiple plot nmarti Rprintf will not build in my C++ compiler Roland Rau R -Legality Question about R's Open Source GNU GPL License Marc Schwartz R -Legality Question about R's Open Source GNU GPL License svga at arcor.de Most often pairs of chars across grouping variable Gary W adding lines to multiple plot Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Ben Bolker adding lines to multiple plot stephen sefick FFT - (STATS) - is this correct? mergullo model mix problem. FALSE CONVERGENCE Martin Henry H. Stevens R -Legality Question about R's Open Source GNU GPL License Wim Bertels odds ratios in multiway tables (stratified) Paulo Cardoso read XML Gerrit Draisma Unexpected line type in lattice plot key on pdf device ajay ohri R -Legality Question about R's Open Source GNU GPL License Michael R command history -- can it be like Matlab's? Gary W adding lines to multiple plot Michael What's the best way to operate R from within Excel? Paul Emberson function to transform response of a formula Martin Morgan read XML Andre Cesta Connecting R to PostgreSQL on Windows. Shubha Vishwanath Karanth "dens" function Andrewjohnclose Re creating Procrustes Plot in Lattice Duncan Murdoch Eclipse/Statet: How to set breakpoints Jim Lemon placing a text in the corner of a plot renata.camargo05 at ntlworld.com FFT - (STATS) - is this correct? M Ensbey Mixed effects model where nested factor is not the repeated across treatments lme??? Gary W adding lines to multiple plots Fán Lóng png() does not generate a 24 bit PNG file Birgitle glm error: factor levels Philipp Pagel Bizarre - R crashes on merge Jim Lemon table questions Philipp Pagel Bizarre - R crashes on merge Duncan Murdoch Eclipse/Statet: How to set breakpoints Paul Emberson function to transform response of a formula Brian Ripley Need help Brian Ripley Need help Birgitle problem with read.table() Williams, Robin Bizarre - R crashes on merge Philipp Pagel problem with read.table() Paul Emberson function to transform response of a formula Paulo Cardoso read XML jim holtman need some help Kenn Konstabel problem with nested loops jim holtman Coarsening the Resolution of a Dataset Tom.O R GUI help Birgitle problem with read.table() Gavin Simpson Re peated Measure ANOVA-Old question Richard Cotton Need help Bart Joosen R command history -- can it be like Matlab's? renata.camargo05 at ntlworld.com Need help Patrizio Frederic Howto Draw Bimodal Gamma Curve with User Supplied Parameters Kurapati, Ravichandra (Ravichandra) need some help Gad Abraham R command history -- can it be like Matlab's? el_eli at gmx.de Eclipse/Statet: How to set breakpoints Andre Cesta Successfully connected GNU R to PostgreSQL on windows XP. Steve Murray Coarsening the Resolution of a Dataset Steve Murray Coarsening the Resolution of a Dataset Mark Difford Re peated Measure ANOVA-Old question Jens Oldeland problem with nested loops renata.camargo05 at ntlworld.com ~ . help Patrizio Frederic What's the best way to operate R from within Excel? Martin Maechler R command history -- can it be like Matlab's? ctu at bigred.unl.edu Re peated Measure ANOVA-Old question

Tuesday, July 29, 2008 130 emails

Moshe Olshansky Urgent Mark Difford Re peated Measure ANOVA-Old question ctu at bigred.unl.edu Repeated Measure ANOVA-Old question Spencer Graves R command history -- can it be like Matlab's? jim holtman Is there a better way to check if an element of a list exists than using match on names? jim holtman how to get the position of a vector-value Katharine Mullen how to get the position of a vector-value Gabor Grothendieck rolling regression between adjacent columns Gabor Grothendieck rollapply() opertation on time series Jörg Groß how to get the position of a vector-value Charles Annis, P.E. Legality Question about R's Open Source GNU GPL License (Ted Harding) table questions David Henderson Legality Question about R's Open Source GNU GPL License Gad Abraham Legality Question about R's Open Source GNU GPL License Duncan Murdoch Colors in Sweave Gad Abraham Legality Question about R's Open Source GNU GPL License dxc13 finding a faster way to do an iterative computation Ben Tupper placing a text in the corner of a plot Rolf Turner placing a text in the corner of a plot Moshe Olshansky Chi-square parameter estimation Bill Venables Help interpreting density(). Jörg Groß placing a text in the corner of a plot Michael What's the best way to operate R from within Excel? Michael R command history -- can it be like Matlab's? Moshe Olshansky finding a faster way to do an iterative computation Paul.Rustomji at csiro.au Is there a better way to check if an element of a list exists than using match on names? rcoder rolling regression between adjacent columns Jorge Ivan Velez placing a text in the corner of a plot Jörg Groß placing a text in the corner of a plot Hadley Wickham R command history -- can it be like Matlab's? rcoder correlation between matrices - both with some NAs rcoder rollapply() opertation on time series Rolf Turner R command history -- can it be like Matlab's? Hadley Wickham R command history -- can it be like Matlab's? Christos Hatzis finding a faster way to do an iterative computation Rolf Turner finding a faster way to do an iterative computation Mike Prager try question Brian Ripley R command history -- can it be like Matlab's? emir.toktar at gmail.com optimize simultaneously two binomials inequalities using nlm jim holtman Coarsening the Resolution of a Dataset Michael R command history -- can it be like Matlab's? jim holtman ls() and memory question David Henderson Legality Question about R's Open Source GNU GPL License Marc Schwartz Graphics function question stephen sefick combining zoo series with an overlapping index? Sarah Goslee List names help Patrizio Frederic table questions dxc13 finding a faster way to do an iterative computation Alessandro Flexible semivariogram in R (HELP) Rajasekaramya List names help Erik Iverson accessing list elements Sarah Goslee Graphics function question ajay ohri Major Cloud Computing Testbed Announced at University of Illinois Ben Bolker Negative Binomial Regression Brian Ripley try question Sarah Goslee accessing list elements Sarah Goslee Graphics function question Brian Ripley Negative Binomial Regression Marc Schwartz Graphics function question Gavin Simpson Panel of pie charts Richard Cotton try question Brian Ripley Removing script file Paul Adams accessing list elements Edna Bell try question stephen sefick combining zoo series with an overlapping index? Peter Flom Graphics function question Edna Bell ls() and memory question Gabor Grothendieck more environment questions Edna Bell more environment questions Edna Bell table questions Max Question regarding statisticians Gabor Grothendieck more environment questions Richard Cotton Panel of pie charts Edna Bell more environment questions Ben Bolker Negative Binomial Regression Luis Reino Bootstraping GAMs for confidence intervales calculation Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Dennis Fisher Removing script file Rajasekaramya subscript out of bounds help Troels Ring lattice question Indermaur Lukas biplot_group_colours_and_point_symbols Rajasekaramya subscript out of bounds error. Roland Rau Case statements in R Marc Schwartz Most often pairs of chars across grouping variable Brian Ripley Negative Binomial Regression svga at arcor.de Most often pairs of chars across grouping variable Christian Hennig About clustering techniques Gabor Grothendieck combining zoo series with an overlapping index? Christian Hennig About clustering techniques ctu at bigred.unl.edu About clustering techniques Steve Murray Coarsening the Resolution of a Dataset pacomet About clustering techniques Gundala Viswanath Howto Draw Bimodal Gamma Curve with User Supplied Parameters John Kane writing the plots stephen sefick combining zoo series with an overlapping index? John Kane Panel of pie charts Gabor Grothendieck combining zoo series with an overlapping index? Charilaos Skiadas keywords stephen sefick combining zoo series with an overlapping index? Felix Andrews How to set the parameters in Trellis Graphics (by Lattice package) Ben Bolker Negative Binomial Regression Brian Ripley Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Brian Ripley Installing BRugs Benno Pütz 'for' loop, two variables ONKELINX, Thierry 'for' loop, two variables Duncan Murdoch 'for' loop, two variables Jim Lemon Is there way to multiple plots on gap.plot? Oehler, Friderike (AGPP) 'for' loop, two variables MAIDER MATEOS DEL PINO optim fails when using arima renata.camargo05 at ntlworld.com stringdot ? Amin Momin Panel of pie charts Zhesi He mac install no font found problem in quartz display Jorge Ivan Velez product of successive rows Uwe Ligges Installing BRugs Paul Adams max Brian Ripley Problem reading a particular file with read.spss() BXC (Bendix Carstensen) Installing BRugs jim holtman list Marisa Laetitia Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Edna Bell keywords Jim Lemon Is there way to multiple plots on gap.plot? Jim Lemon how to add notes to the graph? Chuck Cleland Problem reading a particular file with read.spss() Mark Difford Help interpreting density(). rkevinburton at charter.net Help interpreting density(). Mark Difford Help interpreting density(). rkevinburton at charter.net Help interpreting density(). rkevinburton at charter.net Help interpreting density(). Moshe Olshansky product of successive rows G.H. Zuo How to set the parameters in Trellis Graphics (by Lattice package)

Monday, July 28, 2008 112 emails

Sunday, July 27, 2008 50 emails

Brian Ripley How to set directory Rscript runs in/Sweave output directory Paul.Rustomji at csiro.au How to set directory Rscript runs in/Sweave output directory Henrik Bengtsson Are there any packages that can process images other than pixelmap (i.e. pnm)? Arthur Roberts Are there any packages that can process images other than pixelmap (i.e. pnm)? Sofia Martinez Help with a loop Rolf Turner read.table question Edna Bell read.table question Rolf Turner Converting english words to numeric equivalents Tim Hesterberg Coefficients of Logistic Regression from bootstrap - how to get them? Rolf Turner Mixed model question. Gabor Grothendieck Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) oscar Linares Converting english words to numeric equivalents stephen sefick Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Stas Kolenikov Link functions in SEM Ritwik Sinha Maximization under constraits Ritwik Sinha graphing regression coefficients and standard errors rcoder Rolling regression - o/p selected coefficients rcoder product of successive rows tom soyer help with durbin.watson Satoshi Takahama Object-oriented programming in R for Java programmers? Satoshi Takahama Object-oriented programming in R for Java programmers? Jeroen Ooms Object-oriented programming in R for Java programmers? Hadley Wickham A easy way to write formula joseph 64-bit R on Mac OS X 10.5.4 Famoye, Felix Fitting a Bivariate Poisson log-normal distribution Hadley Wickham melting a list: basic question Johannes Hüsing Object-oriented programming in R for Java programmers? Satoshi Takahama Colors in Sweave Jeroen Ooms Link functions in SEM Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Roger Bivand Spatial Sample BXC (Bendix Carstensen) competing risk model with time dependent covariates under R or Splus Jinsong Zhao response surface analysis Werner Wernersen Object-oriented programming in R for Java programmers? Tom La Bone re sponse surface analysis Arun Kumar Saha Weighted variance function? Arun Kumar Saha Weighted variance function? Mark Difford A easy way to write formula mm745 at st-andrews.ac.uk GLS "no terms component" error ONKELINX, Thierry Retain plot? ONKELINX, Thierry A easy way to write formula Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Arun Kumar Saha Weighted variance function? Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jinsong Zhao A easy way to write formula rkevinburton at charter.net Retain plot? Christophe Genolini S4 : setGeneric for classical methods Brian Ripley Complex to polar? rkevinburton at charter.net Complex to polar?

Saturday, July 26, 2008 71 emails

jim holtman Analyzing Intervals between Data Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE jim holtman Analyzing Intervals between Data Bill Venables GLS "no terms component" error Ashish Kumar Transfer Function Modeling Jia Ying Mei Analyzing Intervals between Data Don MacQueen Data length mismatch. jim holtman Analyzing Intervals between Data Jia Ying Mei Analyzing Intervals between Data John Maindonald Dividing by 0 jim holtman Coarsening the Resolution of a Dataset Steve Murray Coarsening the Resolution of a Dataset Gabor Grothendieck Data length mismatch. Gabor Grothendieck Data length mismatch. Gabor Grothendieck Data length mismatch. Paul Hiemstra Spatial Sample Gabor Grothendieck Data length mismatch. jim holtman Marking Interval Length Gabor Grothendieck Data length mismatch. Raphael Saldanha Spatial Sample Jia Ying Mei Marking Interval Length Raphael Saldanha Sample (Ted Harding) Sample rkevinburton at charter.net Data length mismatch. jim holtman Sample Raphael Saldanha Sample mm745 at st-andrews.ac.uk GLS "no terms component" error jim holtman Marking Interval Length jim holtman Can't get the correct order from melt.data.frame of reshape library. Ben Bolker issues with gap.plot function Marc Schwartz Add a Vector to a Matrix Henrik Bengtsson Remove non-numerical columns from data frame phguardiol at aol.com question about cmprsk library Marc Schwartz Beginning lm Joseph Retzer Thin frame line around R pdf output in LaTeX Mark Difford Beginning lm Peter Dalgaard Remove non-numerical columns from data frame Matthew Keller 64-bit R on Mac OS X 10.4.5 Daren Tan Can't get the correct order from melt.data.frame of reshape library. rkevinburton at charter.net Beginning lm Jia Ying Mei Marking Interval Length Fredrik Lundgren .Rprofile in RFrameworks? laila khalfan parametric bootstrap Zheng Lu issues with gap.plot function ascentnet Add a Vector to a Matrix Henrique Dallazuanna Remove non-numerical columns from data frame Markus Mühlbacher Remove non-numerical columns from data frame milton ruser response surface analysis Martin Morgan how i can install Rgraphviz in R2.7.1 Fotis Papailias S-PLUS code in R Uwe Ligges R-package install Martin Maechler S4 : setGeneric for classical methods phguardiol at aol.com competing risk model with time dependent covariates Fotis Papailias S-PLUS code in R jim holtman Simple vector question. Fotis Papailias S-PLUS code in R Duncan Murdoch S-PLUS code in R Jinsong Zhao response surface analysis Fotis Papailias S-PLUS code in R Duncan Murdoch how i can install Rgraphviz in R2.7.1 Christophe Genolini S4 : setGeneric for classical methods ermimi Help to Text Windoes in Menu with TCL-TK Baptiste Auguie melting a list: basic question Kunio takezawa gam() of package "mgcv" and anova() haani hanni how i can install Rgraphviz in R2.7.1 David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Brian Ripley parametric bootstrap Martin Maechler Write lower half of distance matrix only Brian Ripley Thin frame line around R pdf output in LaTeX Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Brian Ripley R-package install

Friday, July 25, 2008 141 emails

rkevinburton at charter.net Simple vector question. jim holtman error in test Paul Adams error in test jim holtman Simple vector question. rkevinburton at charter.net Simple vector question. jim holtman Help with matrix Van Wyk, Jaap Help with matrix jim holtman Selecting the first measurement only from a longitudinal sequence pgseye Write lower half of distance matrix only jim holtman Matrix from List Felix Andrews Interactive plot using playwith() and abline Hadley Wickham melting a list: basic question Hadley Wickham melting a list: basic question Steven McKinney 64-bit R on Mac OS X 10.4.5 laila khalfan parametric bootstrap joseph 64-bit R on Mac OS X 10.4.5 laila khalfan parametric bootstrap cindy Guo R-package install Duncan Murdoch Numerical question Duncan Murdoch How to pass function argument of same name to internal call? Richard and Barbara Males fit.dist gnlm question, NaN and Inf results Joseph Retzer Thin frame line around R pdf output in LaTeX (Ted Harding) Numerical question Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 stephen sefick Numerical question Nelson Villoria Matrix from List Kumudan Error in vector("double", length) Zhang Yanwei - Princeton-MRAm Numerical question ctu at bigred.unl.edu R: create multi windows plot at the same time Gabor Grothendieck plot zoo custom panel help Carl Witthoft Bug in gap.plot stephen sefick plot zoo custom panel help Carl Witthoft How to pass function argument of same name to internal call? Alessandro R: create multi windows plot at the same time Ferry R-pmg (poor man gui) question Murali K graphing regression coefficients and standard errors David Afshartous Pairs() function: selective changing of ylim; use of key Fotis Papailias s-plus in R... simpler code Gabor Grothendieck plot zoo custom panel help John James Selecting the first measurement only from a longitudinal sequence Patrick Burns Dividing by 0 Andreas Tille Matrix barplot Roland Rau Dividing by 0 Jeffrey_Bromaghin at fws.gov Percentile Estimation From Kernel Density Estimate stephen sefick create multi windows plot at the same time Berend Hasselman transcript a matlab code in R Gabor Grothendieck Rolling range and regression calculations stephen sefick Rolling range and regression calculations ctu at bigred.unl.edu create multi windows plot at the same time Alessandro create multi windows plot at the same time laila khalfan need help in parametric bootstrap Fotis Papailias transcript a matlab code in R Duncan Murdoch Minor Bug in Documentation of merge() Duncan Murdoch Tutorial on rgl Graphics Roland Rau Minor Bug in Documentation of merge() Uwe Ligges R2WinBUGS problem stephen sefick plot zoo custom panel help Ben Bolker Maximization under constraits rcoder Rolling range and regression calculations Andreas Tille Matrix barplot Baptiste Auguie melting a list: basic question Gabor Grothendieck plot zoo custom panel help Frank E Harrell Jr extracting Pr>ltl from robcov/ols (Design) Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd jim holtman Write lower half of distance matrix only Tom La Bone Tutorial on rgl Graphics stephen sefick plot zoo custom panel help Martin Morgan S4 class and Package NAMESPACE [NC] Christoph Scherber Interactive plot using playwith() and abline nmarti Dividing by 0 Dieter Menne melting a list: basic question Duncan Murdoch Tutorial on rgl Graphics Hans W Borchers Fit a 3-Dimensional Line to Data Points Hans-Jörg Bibiko Integrating R and Textmate Rob Goedman Integrating R and Textmate Tom La Bone Tutorial on rgl Graphics milton ruser Insert rows into a pre-existing data frame Baptiste Auguie melting a list: basic question J.delasHeras at ed.ac.uk Saving a workspace with "extras"? Jeffrey S. Racine Package np version 0.20-0 released to CRAN Sarah Goslee Saving a workspace with "extras"? J.delasHeras at ed.ac.uk Saving a workspace with "extras"? naw3 at duke.edu Insert rows into a pre-existing data frame Julio Rojas Chi-square parameter estimation stephen sefick "Multiple" Regressions indexed by goodness of fit Robert Gentleman Plink bed files stephen sefick Scatterplot matrix one column vs. the rest of the dataset Mark Difford extracting Pr>ltl from robcov/ols (Design) Sylvain ARCHENAULT S4 class and Package NAMESPACE [NC] ajay ohri Matrix barplot Martin Morgan Parallel Processing and Linear Regression Douglas Bates glht after lmer with "$S4class-" and "missing model.matrix-" errors stephen sefick Scatterplot matrix one column vs. the rest of the dataset stephen sefick Rolling range and regression calculations Andreas Tille Matrix barplot Federico Calboli Plink bed files Daniela Garavaglia Maximization under constraits Zhang Yanwei - Princeton-MRAm pca David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd ldb extracting Pr>ltl from robcov/ols (Design) Lazarus Mramba Errror in running R2.7.1 version to R2.6.2 version Jim Lemon Matrix barplot Alphonse Monkamg pca rcoder Rolling range and regression calculations Christophe Genolini path and R CMD check pgseye Write lower half of distance matrix only Nutter, Benjamin Matrix barplot Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Andreas Tille Matrix barplot jim holtman Write lower half of distance matrix only Duncan Murdoch Tutorial on rgl Graphics Brian Ripley Fit a 3-Dimensional Line to Data Points Jim Lemon Dividing by 0 Henrique Dallazuanna Building a data frame with missing data pgseye Write lower half of distance matrix only Jim Lemon Relying on R to generate html tables with hyperlinks and pictures ? Jim Lemon Bug in gap.plot Natalia Quinteros Building a data frame with missing data Tom La Bone Tutorial on rgl Graphics silvia narduzzi cannot allocate vector of size... Achim Zeileis Rolling range and regression calculations Gabor Grothendieck Formatting Syntax when Merging Uwe Ligges cannot allocate vector of size... Christoph Scherber Three contrast matrices on the same linear model Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors Dimitris Rizopoulos Help with rep Gábor Csárdi Help with rep Peter Dalgaard Help with rep Van Wyk, Jaap Help with rep Sean O'Riordain discrete event simulation - "factory" with rework Uwe Ligges path and R CMD check David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Brian Ripley Error - unable to load shared library Richard Cotton Fit a 3-Dimensional Line to Data Points Uwe Ligges Integrating R and Textmate Uwe Ligges Bug in gap.plot Brian Ripley problem in choosing cran mirror ! Uwe Ligges problem in choosing cran mirror ! Brian Ripley Installation error for RCurl in Redhat enterrpise 5 Brian Ripley R-package install

Thursday, July 24, 2008 142 emails

deepti nigam problem in choosing cran mirror ! S. M. Niaz Arifin Fit a 3-Dimensional Line to Data Points Gabor Grothendieck Create an R package Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 Rolf Turner simple random number generation Arthur Roberts Bug in gap.plot S Ellison simple random number generation Kyeongmi Cheon nlminb--lower bound for parameters are dependent on each others Moshe Olshansky simple random number generation jim holtman simple random number generation Daren Tan Relying on R to generate html tables with hyperlinks and pictures ? Jia Ying Mei How to.... Austin, Matt How to preserve the numeric format and digits ? FScottDahlgren Create an R package milton ruser How to preserve the numeric format and digits ? rcoder Rolling range and regression calculations Jia Ying Mei How to.... Daren Tan How to preserve the numeric format and digits ? David Freedman ggplot2 help dxc13 simple random number generation Don MacQueen Installing R packages in Textmate Jeffrey Horner ANNOUNCE: rapache 1.1.0 release Christopher W. Ryan OT: course in research administration Arthur Roberts Installing R packages in Textmate Arthur Roberts Integrating R and Textmate Rolf Turner still more dumb questions Edna Bell still more dumb questions David Scott Interactive plot Carl Witthoft NAs - NAs are not allowed in subscripted assignments John Fox sem & testing multiple hypotheses with BIC (Ted Harding) Should this PDF render correctly without font embedding? Rolf Turner Should this PDF render correctly without font embedding? Michael Lawrence error with .dll file and RGtk2 cindy Guo R-package install stephen sefick Should this PDF render correctly without font embedding? stephen sefick Question: how to build a subset to do separate calculations stephen sefick Question: how to build a subset to do separate calculations Erik Iverson Question: how to build a subset to do separate calculations Mark Difford R-package install Erik Iverson Question: how to build a subset to do separate calculations Jeffrey Horner Should this PDF render correctly without font embedding? Philipp Pagel Cairo graphics Claire Delle Luche SPR experiment: using lmer, transforming data, collinearity, and using a covariable Kenn Konstabel Subsetting an array by a vector of dimensions Edna Bell Cairo graphics John Kane Coefficients of Logistic Regression from bootstrap - how to get them? Rolf Turner Dividing by 0 Edna Bell ggplot2 help Mark Difford factor question Spencer Question: how to build a subset to do separate calculations Henrique Dallazuanna factor question Edna Bell factor question Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Hans W Borchers Coconut benchmark for R? Frank E Harrell Jr [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? mm745 at st-andrews.ac.uk Problem with GLS dwtest function Senthil Purushothaman Calculating Betweenness - Efficiency problem Hans W Borchers How to get rule number in arules cindy Guo R-package install Ben Bolker Help with which() Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Alan Spearot Parallel Processing and Linear Regression Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Robert Baer Dividing by 0 Jia Ying Mei Formatting Syntax when Merging Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Bert Gunter Coefficients of Logistic Regression from bootstrap - how to get them? Erik Iverson Help with which() (Ted Harding) Help with which() Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Ben Bolker Help with which() Christoph Scherber What is wrong with this contrast matrix? (Ted Harding) What is wrong with this contrast matrix? Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Hadley Wickham ggplot question Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Erik Iverson Help with which() naw3 at duke.edu Help with which() Christoph Scherber What is wrong with this contrast matrix? Brian Ripley error with .dll file and RGtk2 Uwe Ligges Problem with scatterplot3d example Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Michal Figurski [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments paulandpen error with .dll file and RGtk2 Patrizio Frederic How to delete duplicate cases? Marc Schwartz How to delete duplicate cases? Gavin Simpson Weighted variance function? Dimitris Rizopoulos incrementing for loop by 2 Erik Iverson How to delete duplicate cases? Henrique Dallazuanna How to delete duplicate cases? Jorge Ivan Velez How to delete duplicate cases? Wacek Kusnierczyk incrementing for loop by 2 Duncan Murdoch how know the status of particular process Marc Schwartz incrementing for loop by 2 Youngik Yang Error - unable to load shared library Daniel Wagner How to delete duplicate cases? PIKAL Petr Odp: sum each row and output results nmarti Dividing by 0 Gabor Grothendieck how to export ".xls" file with colorful cells? Kurapati, Ravichandra (Ravichandra) how know the status of particular process Troels Ring R2WinBUGS problem TL Vincent Multinomial logistic regression with non-numerical data. Marc Schwartz how to export ".xls" file with colorful cells? Richard Cotton NAs - NAs are not allowed in subscripted assignments Clark, Jennifer H incrementing for loop by 2 René Capell Is there an equivalent * operator? Felix Andrews Is there an equivalent * operator? Duncan Murdoch Interactive plot john seers (IFR) Just 2 more questions - for now! Megh Dal Interactive plot Duncan Murdoch Problem with scatterplot3d example Duncan Murdoch Just 2 more questions - for now! Mark Difford Just 2 more questions - for now! Duncan Murdoch Interactive plot Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments Tom La Bone Problem with scatterplot3d example stephen sefick Just 2 more questions - for now! Megh Dal Interactive plot Henrique Dallazuanna convert a vector of words into a matrix Wacek Kusnierczyk convert a vector of words into a matrix giuseppe1.milicia at hsbcib.com Problems with Rmpi and LAM 7.1.4 Williams, Robin Just 2 more questions - for now! Luis Reino Bootstraping GAMs: confidence intervals Jim Lemon Using PrettyR to produce LaTeX output john seers (IFR) Is there an equivalent * operator? Duncan Murdoch Is there an equivalent * operator? Gérard Henry unable to load a library Williams, Robin Is there an equivalent * operator? Daniel Wagner How to get rule number in arules Brian Ripley time zone - best way to shift hours Imanpreet Coconut benchmark for R? Wacek Kusnierczyk convert a vector of words into a matrix Daren Tan convert a vector of words into a matrix David Carslaw time zone - best way to shift hours Brian Ripley Functions similar to step() and all.effects() that work for lme() objects? Patrick Burns convert a vector of words into a matrix Christoph Scherber Functions similar to step() and all.effects() that work for lme() objects? Christoph Scherber lmer model with continuos non normal response variable, transformation needed? Peter Dalgaard how can I write code to detect whether the machine is Windows or Linux? Williams Scott ggplot question

Wednesday, July 23, 2008 178 emails

Tuesday, July 22, 2008 144 emails

Monday, July 21, 2008 117 emails

ae2356 at hotmail.com xyplot help ascentnet Accessing individual variables from summary of lm Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Andrew Yee with lapply() how can you retrieve the name of the object John Smith Lattice: How to draw curves from given formulae Liaw, Andy confusion matrix in randomForest Deepayan Sarkar Conditionally Updating Lattice Plots Alessandro experimental semivariogram Duncan Murdoch Using integrate Rheannon how to speed up this for loop? Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Doran, Harold Large number of dummy variables Douglas Bates Large number of dummy variables Bert Gunter Large number of dummy variables Doran, Harold Large number of dummy variables Alan Spearot Large number of dummy variables Alan Spearot Large number of dummy variables Tony Plate name returned by lapply John Smith how to draw multiples curses (for given formulae) in lattice Bill Cunliffe y-axis number format on plot, barplot etc. Ben Bolker Control parameter of the optim( ): parscale Rolf Turner Table of tables? Ayman Oweida Using integrate Charles C. Berry avoid loop with three-dimensional array Patrick Connolly Howto Restart A Function with Try-Error Catch Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Rolf Turner Parameter names in nls Rolf Turner Editor fpr Mac OS (Ted Harding) Coefficients of Logistic Regression from bootstrap - how 刘杰 Coefficients of Logistic Regression from bootstrap - how to get them? Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? emir.toktar at computer.org optimize function help!! Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Dimitris Rizopoulos vector help Don MacQueen Editor fpr Mac OS Henrique Dallazuanna lattice with bwplot Henrique Dallazuanna vector help Jorge Ivan Velez vector help Hans W Borchers Editor fpr Mac OS Rajasekaramya vector help Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Zornitsa Luleva Control parameter of the optim( ): parscale Julian Burgos Mclust - which cluster is each observation in? Angelo Scozzarella Editor fpr Mac OS Greg Snow asp and ylim Roberts, Kyle lattice with bwplot Abhijit Dasgupta Output Nicely formatted tables from R Greg Snow TeachingDemos question: my.symbols() alignment problems in complicated layout José Augusto Jr. portfolio optimization problem - use R Bill Cunliffe Output Nicely formatted tables from R Brian Ripley dev2bitmap error, 'gs' cannot be found Jon Hak manipulate a matrix2 jim holtman manipulate a matrix2 Richard Pearson Creation of png=problems rhelp.20.trevva at spamgourmet.com Parameter names in nls Jon Hak manipulate a matrix2 Fotis Papailias Time Series - Long Memory Estimation cnagy Mclust - which cluster is each observation in? Boel Brynedal dev2bitmap error, 'gs' cannot be found jim holtman On creating grouped data set. Sebastian Weber xyplot: distance between axis and axis-label gets wrong jim holtman manipulate a matrix2 Ravi Varadhan How to solve systems of nonlinear equations in R? Romain Creation of png=problems Michela Cameletti Avoid loop with three-dimensional array Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? fzp2008 portfolio optimization problem - use R Gabor Grothendieck Subsetting data by date Michela Cameletti avoid loop with three-dimensional array John Kane Subsetting data by date John Kane Subsetting data by date Williams, Robin Subsetting data by date Williams, Robin Subsetting data by date Gabor Grothendieck Subsetting data by date maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Jon Hak manipulate a matrix2 Dylan Beaudette alternate usage of soil.texture (plotrix) Gabor Grothendieck Subsetting data by date Martin Maechler asp and ylim David Epstein asp and ylim Williams, Robin Subsetting data by date Gundala Viswanath Howto Restart A Function with Try-Error Catch Nora Hanson Cross correlation significance test Paulo Barata drawing segments through points with pch=1 (Ted Harding) Getting plot axes where they should be! (Ted Harding) Getting plot axes where they should be! Nora Hanson Cross correlation significance test Duncan Murdoch Getting plot axes where they should be! Marc Schwartz Getting plot axes where they should be! (Ted Harding) Getting plot axes where they should be! Fotis Papailias Time Series - Long Memory Estimation Fotis Papailias Time Series - Long Memory Estimation Brian Ripley par("din") vs dev.size() José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Brown, Andrew A help with integrate function Dong-hyun Oh On creating grouped data set. Achim Zeileis CART and CHAID Martin Maechler drawing segments through points with pch=1 Martin Maechler asp and ylim Denise Xifara fama-macbeth Juliane Struve sampling from a list of values while excluding one jim holtman sampling from a list of values while excluding one Jim Lemon drawing segments through points with pch=1 Denise Xifara fama-macbeth Chua Siang Li CART and CHAID Juliane Struve sampling from a list of values while excluding one David Epstein asp and ylim Yunlei.Hu at barclayscapital.com A question on the quandratic programming Gábor Csárdi Calculating Betweenness - Efficiency problem David Epstein asp and ylim Brian Ripley Erro: cannot allocate vector of size 216.0 Mb Uwe Ligges Erro: cannot allocate vector of size 216.0 Mb Tobias Verbeke CART Analysis Darin Brooks CART Analysis M Perez SVM: Graphical representation Brian Ripley CART and CHAID Brian Ripley RODBC - problems using odbcDriverConnect without DSN

Sunday, July 20, 2008 78 emails

Chua Siang Li CART and CHAID Gabor Grothendieck Lattice Version of grconvertX or variant on panel.text? Josiah Walker RODBC - problems using odbcDriverConnect without DSN Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Bryan Hanson Lattice Version of grconvertX or variant on panel.text? jim holtman Sum efficiently from large matrix according to re-occuring levels of factor? Hadley Wickham Lattice Version of grconvertX or variant on panel.text? Bryan Hanson Lattice Version of grconvertX or variant on panel.text? rkevinburton at charter.net smooth.spline Hadley Wickham TeachingDemos question: my.symbols() alignment problems in complicated layout Paul Murrell TeachingDemos question: my.symbols() alignment problems in complicated layout Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Paulo Barata coin package (conditional inference / permutation): parameter teststat Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Paul Smith asp and ylim Brian Ripley asp and ylim Gabor Grothendieck asp and ylim David Epstein asp and ylim Gabor Grothendieck enumerate subsets Peter Dalgaard enumerate subsets jim holtman enumerate subsets jim holtman Erro: cannot allocate vector of size 216.0 Mb Rolf Turner asp and ylim jim holtman Access to values of function arguments lamack lamack enumerate subsets Hans W Borchers Non-linearly constrained optimisation José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Mike Lawrence Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails) willemf Access to values of function arguments Gabor Grothendieck Erro updating HTML package descriptions in packages.html Steve Murray Matching Up Values David Epstein asp and ylim José Augusto Jr. Erro updating HTML package descriptions in packages.html Gabor Grothendieck Erro updating HTML package descriptions in packages.html Uwe Ligges Erro updating HTML package descriptions in packages.html Gabor Grothendieck Conditionally Updating Lattice Plots Marc Schwartz fill in area between 2 lines with a color Dimitris Rizopoulos fill in area between 2 lines with a color José Augusto Jr. Erro updating HTML package descriptions in packages.html Bryan Hanson Conditionally Updating Lattice Plots David Freedman fill in area between 2 lines with a color Sascha Bellaire Indicator Kriging? Marc Schwartz Access to values of function arguments Brian Ripley Access to values of function arguments Spencer Graves smooth.spline Duncan Murdoch smooth.spline Hans W Borchers principal factor analysis Spencer Graves smooth.spline Dieter Menne R interprets symbol as q() David Epstein drawing segments through points with pch=1 Brian Ripley drawing segments through points with pch=1 willemf Access to values of function arguments Fido How do I install Joomla! 1.5? Uwe Ligges drawing segments through points with pch=1 Frank E Harrell Jr Discretize continous variables.... Paul Smith drawing segments through points with pch=1 David Epstein drawing segments through points with pch=1 David Epstein Error in edit(name,file,title,editor) Bernardo Rangel Tura calculate differences - strange outcome (Ted Harding) Order of columns(variables) in dataframe Dimitris Rizopoulos Order of columns(variables) in dataframe jim holtman Error in edit(name,file,title,editor) jim holtman Order of columns(variables) in dataframe Daniel Wagner Order of columns(variables) in dataframe David Epstein Error in edit(name,file,title,editor) Göran Broström Parametric survival models with left truncated, right censored data jim holtman R interprets symbol as q() jim holtman problem with read.table Roger Leenders R interprets symbol as q() Gabor Grothendieck estimating volume from xyz points carol white problem with read.table Johannes Hüsing Discretize continous variables.... Mark Difford R version 2.7.1 (warnings) Christophe Genolini Sweave add code \201 Van Wyk, Jaap R version 2.7.1 (warnings) carol white problem with read.table

Saturday, July 19, 2008 63 emails

Ralph S. replicate matrix blocks different numbers of times into new matrix Hadley Wickham smooth.spline rkevinburton at charter.net smooth.spline Gabor Grothendieck Non-linearly constrained optimisation Stuart Nettleton Non-linearly constrained optimisation Miklos Kiss confusion matrix in randomForest Frank E Harrell Jr Discretize continous variables.... jim holtman replicate matrix blocks different numbers of times into new matrix Ralph S. replicate matrix blocks different numbers of times into new matrix jim holtman Calculating Betweenness - Efficiency problem Frank E Harrell Jr Discretize continous variables.... Johannes Hüsing Discretize continous variables.... tolga.i.uzuner at jpmorgan.com Non-linearly constrained optimisation milicic.marko Discretize continous variables.... Senthil Purushothaman Calculating Betweenness - Efficiency problem Göran Broström Likelihood ratio test between glm and glmer fits milton ruser estimating volume from xyz points hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times milton ruser wroung groupedData despite reading Bates and Pinheiro 3 times hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times Peter Dalgaard replicate matrix blocks different numbers of times into new matrix Peter Dalgaard Sweave add code \201 Ralph S. replicate matrix blocks different numbers of times into new matrix Christophe Genolini Sweave add code \201 Frank E Harrell Jr Discretize continous variables.... Tolga Uzuner Title for graph with multiple plots Daniel Malter Discretize continous variables.... (Ted Harding) Title for graph with multiple plots jim holtman Title for graph with multiple plots Gabor Grothendieck extracting colnames to label plots in a function stephen sefick extracting colnames to label plots in a function Patrick Burns initialize a factor vector stephen sefick extracting colnames to label plots in a function Gabor Grothendieck extracting colnames to label plots in a function stephen sefick extracting colnames to label plots in a function Albin Blaschka Change font-face in title stephen sefick extracting colnames to label plots in a function Frank E Harrell Jr Discretize continous variables.... Gabor Grothendieck Change font-face in title jim holtman Change font-face in title Gabor Grothendieck Change font-face in title Jinsong Zhao principal factor analysis Albin Blaschka Change font-face in title Bernardo Rangel Tura Resshufling algorithm (Thiago Souza) dej500 at york.ac.uk fixed effect significance with lmer() vs. t-test Patrick Burns initialize a factor vector Daniel Malter Discretize continous variables.... Vincent Goulet Graphics not working for R in ubuntu Frank E Harrell Jr Discretize continous variables.... Thiago Souza Resshufling algorithm (Thiago Souza) Johannes Hüsing initialize a factor vector milicic.marko Discretize continous variables.... Christophe Dutang system time - windows specific problem jim holtman Calculating Betweenness - Efficiency problem Berend Hasselman How to solve systems of nonlinear equations in R? Duncan Murdoch system time - windows specific problem Tolga Uzuner Title for graph with multiple plots Simon Anders t-test for multiple variables Michael Bibo Graphics not working for R in ubuntu Mose Andre Graphics not working for R in ubuntu ONKELINX, Thierry "Spreading risk" in a matrix Mark Difford R version 2.7.1 (warnings) Van Wyk, Jaap R version 2.7.1 (warnings)

Friday, July 18, 2008 98 emails

Nataraj Graphics not working for R in ubuntu Stuart Nettleton How to solve systems of nonlinear equations in R? jim holtman problem with putting text in outer margins (mtext outer=TRUE) François Aucoin How to solve systems of nonlinear equations in R? Judith Flores Retrieving data from a tcl /tk function Jorge Ivan Velez with lapply() how can you retrieve the name of the object jim holtman with lapply() how can you retrieve the name of the object Janet Young problem with putting text in outer margins (mtext outer=TRUE) jim holtman with lapply() how can you retrieve the name of the object Jorge Ivan Velez with lapply() how can you retrieve the name of the object Andrew Yee with lapply() how can you retrieve the name of the object Mark Leeds spreading the risk Christophe Dutang system time - windows specific problem Julian Burgos using which to identify a range of values ACroske "Spreading risk" in a matrix Senthil Purushothaman Calculating Betweenness - Efficiency problem ONKELINX, Thierry "Spreading risk" in a matrix Jon Zadra Functions similar to step() and all.effects() that work for lme() objects? Sébastien Bihorel using which to identify a range of values Gabor Grothendieck How to cut data elements included in a text line Henrique Dallazuanna using which to identify a range of values sj using which to identify a range of values ACroske "Spreading risk" in a matrix Jorge Ivan Velez How to cut data elements included in a text line Henrique Dallazuanna How to cut data elements included in a text line jim holtman histogram plot default Yupu Liang copy number estimation through oligo package? CJ Jackson Polynomial Approximation with Exponential Kernel tolga.i.uzuner at jpmorgan.com Landscape mode for pdf Peter Dalgaard Reading SPSS .por files Gregory R. Warnes REvolution computing Christine A. How to cut data elements included in a text line Sarah Goslee par("din") vs dev.size() jim holtman Landscape mode for pdf Henrique Dallazuanna re ad and check table Henrique Dallazuanna cbind help Rajasekaramya cbind help jim holtman manipulate a matrix2 Johannes Hüsing Landscape mode for pdf Charles Annis, P.E. REvolution computing mysimbaa re ad and check table Stephen Kennedy dataedit Brian Ripley Reading SPSS .por files Spencer Graves smooth.spline Jon Hak manipulate a matrix2 Jose Iparraguirre D'Elia Reading SPSS .por files tolga.i.uzuner at jpmorgan.com Landscape mode for pdf tolga.i.uzuner at jpmorgan.com creating names for lists Brian Ripley Reading SPSS .por files Jose Iparraguirre D'Elia Reading SPSS .por files Roland Rau Problem with TLC/TK on Ubuntu silvia narduzzi errors using step function Roland Rau smooth.spline Antje name returned by lapply Henrique Dallazuanna creating names for lists tolga.i.uzuner at jpmorgan.com creating names for lists Shubha Vishwanath Karanth A neural network problem---neuralnet package Gavin Simpson source code functions Henrique Dallazuanna source code functions Brian Ripley Reading SPSS .por files stephen sefick source code functions stephen sefick finding "chuncks" of data that have no NA s Henrique Dallazuanna only "T" becomes logical colum with read.table Antje name returned by lapply Luis F only "T" becomes logical colum with read.table Gabor Grothendieck finding "chuncks" of data that have no NA s Dimitris Rizopoulos generate repeats of a vector's elements Antje generate repeats of a vector's elements Gavin Simpson name returned by lapply Albin Blaschka Change font-face in title stephen sefick finding "chuncks" of data that have no NA s Christophe Genolini probleme with R CMD check Chaofeng Kou generate repeats of a vector's elements Antje name returned by lapply Jose Iparraguirre D'Elia Reading SPSS .por files Gavin Simpson name returned by lapply Gabor Grothendieck finding "chuncks" of data that have no NA s Antje name returned by lapply Gregory R. Warnes Correction: RStat version 2.7.*1* now available Uwe Ligges REvolution computing Henning Wildhagen t-test for multiple variables Steve Murray Matching Up Values Gregory R. Warnes RStat version 2.7.2 now available stephen sefick finding "chuncks" of data that have no NA s Simon Anders t-test for multiple variables Gregory R. Warnes REvolution computing Henning Wildhagen t-test for multiple variables Doran, Harold matrix multiplication question Martin Maechler probleme with R CMD check Stuart Nettleton Equation sequencing Christophe Genolini probleme with R CMD check Patrick Burns function "eigen" AND Minitab Patrick Burns column wise paste of data.frames Dimitris Rizopoulos column wise paste of data.frames Bill Venables function "eigen" AND Minitab Sebastian Weber column wise paste of data.frames SH.Chou function "eigen" AND Minitab Charlotte Falk Mogensen Installation of garchOxFit

Thursday, July 17, 2008 100 emails

Tsjerk Wassenaar matrix multiplication question Duncan Murdoch matrix multiplication question Marc Schwartz size and coding error in plot ? Hadley Wickham size and coding error in plot ? jim holtman Function to create variables with prefix shetumi at aim.com size and coding error in plot ? Murali K matrix multiplication question shetumi at aim.com size and coding error in plot ? Hadley Wickham Matching Up Values Spencer Graves smooth.spline Jason Lee How to convert/map jacktest results to dataframe or file Davide Massidda Problem with TLC/TK on Ubuntu Erik Iverson Problem with TLC/TK on Ubuntu Dirk Eddelbuettel Problem with TLC/TK on Ubuntu Charles C. Berry combining lists of pairs Davide Massidda Problem with TLC/TK on Ubuntu David Henderson REvolution computing Moira Burke Function to create variables with prefix olvrmrs at aol.com combining lists of pairs Mark Difford Newbie's question about lm Rolf Turner Matching Up Values Iain Gallagher Help with data layout - Thanks Jacob Wegelin nested calls, variable scope rkevinburton at charter.net smooth.spline Peter Alspach Matching Up Values Jacob Wegelin nested calls, variable scope Steve Murray Matching Up Values Charles C. Berry Sampling distribution (PDF & CDF) of correlation H. Paul Benton ubuntu and rgl package vs suse ?? static plots Duncan Murdoch ubuntu and rgl package vs suse ?? static plots H. Paul Benton ubuntu and rgl package vs suse ?? static plots Erik Iverson Display variables when running a script Stephan Kolassa Display variables when running a script Marc Schwartz REvolution computing jim holtman Display variables when running a script Frank E Harrell Jr Comparing differences in AUC from 2 different models naw3 at duke.edu Display variables when running a script Mariana Carla Gambarotta REvolution computing (Ted Harding) Labelling curves on graphs Marc Schwartz Hiding information about functions in newly developed packages Bert Gunter Hiding information about functions in newly developed packages Michael Lawrence help with data layout Peter Dalgaard Hiding information about functions in newly developed packages jim holtman help with data layout Martin Maechler negative P-values with shapiro.test Satoshi Takahama help with data layout Henrique Dallazuanna help with data layout di jianing Can mvtnorm calculate a sequence of probabilities? Erik Iverson help with data layout Patrick Richardson keeping seperate row.names Maria Rizzo Sampling distribution (PDF & CDF) of correlation Tudor Bodea Hiding information about functions in newly developed packages Iain Gallagher help with data layout Earl F. Glynn Colours in R Ptit_Bleu Newbie's question about lm Michael Lawrence Sampling distribution (PDF & CDF) of correlation Peter Dalgaard enscript states file for R scripts? Greg Snow Histogram with two colors depending on condition PIKAL Petr Odp: Graph PIKAL Petr Odp: Colours in R Lyman, Mark Problem with mpi.close.Rslaves() Leandro Marino RES: Colours in R Duncan Murdoch Colours in R Leandro Marino Colours in R Marco Chiapello Graph Monica Pisica Comparing differences in AUC from 2 different models silvia narduzzi errors using step function Robert Re : Re : float and double precision with C code Christoph Scherber lm() question Robert Re : float and double precision with C code Christoph Scherber Problems with lm() jim holtman float and double precision with C code Wacek Kusnierczyk spliting a string Robert float and double precision with C code Kurapati, Ravichandra (Ravichandra) how to split the string Jim Lemon spliting a string Felix Andrews barchart with bars attached to y=0-line Xin Shi histogram plot default Kurapati, Ravichandra (Ravichandra) spliting a string Henning Wildhagen barchart with bars attached to y=0-line Mikhail Spivakov fastICA Frank E Harrell Jr Labelling curves on graphs Douglas Bates Likelihood ratio test between glm and glmer fits Berwin A Turlach NAMESPACE vs internal.Rd Duncan Murdoch calculate differences - strange outcome Mark Difford calculate differences - strange outcome Berwin A Turlach calculate differences - strange outcome PIKAL Petr Odp: calculate differences - strange outcome iwhite@staffmail.ed.ac.uk model.tables standard errors Kunzler, Andreas calculate differences - strange outcome Hadley Wickham Histogram with two colors depending on condition Gundala Viswanath How to compute loglikelihood of Lognormal distribution Mark Difford help with bivariate density plot question jim holtman Histogram with two colors depending on condition Ehsan Karim Histogram with two colors depending on condition Rune Haubo Likelihood ratio test between glm and glmer fits Uwe Ligges plot(linear model) without lines Barry Rowlingson Labelling curves on graphs Uwe Ligges how i can install Rgraphviz in R2.7.1 Emmanuel Charpentier shapiro wilk normality test

Wednesday, July 16, 2008 82 emails

haani hanni how i can install Rgraphviz in R2.7.1 Jan Smit Location of HTML help files Henrik Bengtsson Location of HTML help files Frank E Harrell Jr Labelling curves on graphs Jan Smit Location of HTML help files jim holtman Help regarding arules package Moshe Olshansky spectral decomposition for near-singular pd matrices Rolf Turner Stratified random sample Jason Lee How to extract component number of RMSEP in RMSEP plot Daniel Malter Stratified random sample jp d create a function from a model Rolf Turner Stratified random sample Prasenjit Kapat spectral decomposition for near-singular pd matrices Christopher W. Ryan plot(linear model) without lines Moshe Olshansky spectral decomposition for near-singular pd matrices Jin Wang 回复: cch() and coxph() for case-cohort Alessandro R: R: gstat problem with lidar data lamack lamack Stratified random sample Barry Rowlingson Labelling curves on graphs Christophe Genolini R logo Earl F. Glynn Function to verify existence of an R object Duncan Murdoch Function to verify existence of an R object Bert Gunter Function to verify existence of an R object Judith Flores Function to verify existence of an R object Prasenjit Kapat spectral decomposition for near-singular pd matrices Dylan Beaudette R: gstat problem with lidar data stefano iacus R logo (Ted Harding) Labelling curves on graphs Austin, Matt Labelling curves on graphs Gabor Grothendieck RSQLite maximum table size (Ted Harding) Labelling curves on graphs Vidhu Choudhary RSQLite maximum table size Dylan Beaudette gstat problem with lidar data Bert Gunter Mapping data onto score jim holtman Mapping data onto score Daniela Carollo help with bivariate density plot question rcoder Mapping data onto score rcoder Mapping data onto score Alessandro gstat problem with lidar data Peter Dalgaard aov error with large data set Dimitris Rizopoulos Likelihood ratio test between glm and glmer fits Gabor Grothendieck date to decimal date conversion Deepayan Sarkar barchart with bars attached to y=0-line L. Jay Roberts Help with rpart.predict? Assaf oron Confidence bands for model estimates using ns() spline basis Christophe Genolini NAMESPACE vs internal.Rd Corey Sparks Likelihood ratio test between glm and glmer fits Lyman, Mark Problem with mpi.close.Rslaves() Martin Maechler negative P-values with shapiro.test Henrique Dallazuanna Output design question Kate Forecasting enrollments with fuzzy time series Daniel Wagner Help regarding arules package Michael Kubovy Output design question Berwin A Turlach NAMESPACE vs internal.Rd Michael Friendly extracting elements from print object of Manova() Christophe Genolini NAMESPACE vs internal.Rd Berwin A Turlach NAMESPACE vs internal.Rd Birgit Lemcke randomForest outlier Christophe Genolini NAMESPACE vs internal.Rd Duncan Murdoch R-source code of a function Birgit Lemcke randomForest outlier arezoo bagheri R-source code of a function Liaw, Andy randomForest outlier Gabor Grothendieck barchart with bars attached to y=0-line Jason Lee How to extract component number of RMSEP in RMSEP plot Yogesh Tiwari date to decimal date conversion stephen sefick code reduction (if anyone feels like it) Henning Wildhagen barchart with bars attached to y=0-line Gábor Csárdi Font quality in base graphics Gábor Csárdi Font quality in base graphics Mark Difford Font quality in base graphics silvia narduzzi problem Mark Difford Font quality in base graphics jim holtman Group level frequencies Dimitris Rizopoulos Group level frequencies Christophe Genolini R logo Kunzler, Andreas Group level frequencies Paul Hiemstra Howto view function's source code of an installed package Martin Maechler R logo willemf Font quality in base graphics Angila Albaros Regression problem Gundala Viswanath Howto view function's source code of an installed package

Tuesday, July 15, 2008 133 emails

mysimbaa eval.wih.vis Detlef Steuer Problem installing R on openSUSE 10.3 Steve Frost Simulate data with binary outcome Mark Cowley negative P-values with shapiro.test Vincent Goulet Help Updating and Installing R Packages Vincent Goulet Insurance review statistical methods Christofer Bogaso Off-topic - Data needed Jason Lee How to extract component number of RMSEP in RMSEP plot Tariq Perwez Help Updating and Installing R Packages Frank E Harrell Jr meaning of tests presented in anova(ols(...)) {Design package} jim holtman code reduction (if anyone feels like it) jim holtman code reduction (if anyone feels like it) Christophe Genolini R logo Ray Brownrigg New Zealand Maps Nordlund, Dan (DSHS/RDA) Row Sum, exclude positive values Ray Brownrigg New Zealand Maps Jim Lemon Row Sum, exclude positive values Jin Wang implementation of Prentice method in cch() Tom Love New Zealand Maps Jorge Ivan Velez Row Sum, exclude positive values Jim Lemon Mapping data onto 1-10 score stephen sefick code reduction (if anyone feels like it) Jim Lemon Exporting an list() Jim Lemon Convert data set to data frame Jim Lemon Off topic: Tcl/Tk outside R. rcoder Mapping data onto score Steve Murray Melt (reshape) question jim holtman tryCatch - return from function to main script Hadley Wickham Melt (reshape) question jim holtman code reduction (if anyone feels like it) jim holtman Melt (reshape) question Bert Gunter What package to use to create a GUI Judith Flores What package to use to create a GUI jim holtman Filtering output Rheannon Row Sum, exclude positive values Ben Tupper Mapping data onto score rcoder Mapping data onto score Steve Murray Melt (reshape) question Michael Lawrence playwith package crashes on Mac Rolf Turner Iterations rkevinburton at charter.net Filtering output Ben Tupper Mapping data onto score Mike Prager Font quality in base graphics Donald Braman sem & testing multiple hypotheses with BIC Nordlund, Dan (DSHS/RDA) Iterations Erik Iverson Iterations Mark Difford Font quality in base graphics Henrique Dallazuanna POSIXct extract time stephen sefick POSIXct extract time De Tuimelaar generalized spatial autoregressive lag model stephen sefick POSIXct extract time rkevinburton at charter.net Iterations willemf Font quality in base graphics Boyce, Morgan matplot help larry88 how to get confidential interval for classification accuracy using 10-fold validation in svm package rkevinburton at charter.net Iterations stephen sefick code reduction (if anyone feels like it) Susan Amrose .First and .Rprofile won't run on startup INSEED statistics workshop INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R) INSEED statistics workshop INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R Jorge Ivan Velez extracting elements from print object of Manova() Erik Iverson Regression problem stephen sefick Help with maptools sunriset() Douglas Bates Regression problem Erik Iverson Iterations Michael Rennie Iterations Michael Rennie Iterations Jeff Newmiller Iterations Stephan Kolassa Iterations stephen sefick sunrise sunset calculations Riley, Steve counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Michael Lawrence aov error with large data set rkevinburton at charter.net Iterations Chuck Cleland sunrise sunset calculations A Ezhil Problem installing R on openSUSE 10.3 stephen sefick sunrise sunset calculations stephen sefick Calculating Stream Metabolism Patrick Aboyoun counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Detlef Steuer Problem installing R on openSUSE 10.3 Wolfgang Huber counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jeffrey Horner Font quality in base graphics Michael Rennie manipulating (extracting) data from distance matrices Sarah Goslee manipulating (extracting) data from distance matrices Jon Olav Skoien manipulating (extracting) data from distance matrices Henrik Bengtsson counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Ken Knoblauch counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Daren Tan counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Patrick Burns Regression problem Michael Rennie extracting elements from print object of Manova() John Kane long data frame selection error Birgitle randomForest outlier Jeremy MAZET DOE for logistic models Felix Andrews playwith package crashes on Mac A Ezhil Problem installing R on openSUSE 10.3 Liaw, Andy Random Forest %var(y) Michael Rennie manipulating (extracting) data from distance matrices Jorge Ivan Velez Exporting an list() willemf Font quality in base graphics Dirk Eddelbuettel enscript states file for R scripts? stephen sefick manipulating (extracting) data from distance matrices Henrique Dallazuanna Exporting an list() Leandro Marino Exporting an list() Michael Rennie manipulating (extracting) data from distance matrices Zroutik Zroutik creating axis of the plot before data are plotted -- solved rkevinburton at charter.net Assoociative array? rkevinburton at charter.net Assoociative array? Michael Kubovy playwith package crashes on Mac rkevinburton at charter.net Assoociative array? Thomas Fröjd Layers in graphs rcoder Mapping data onto score rcoder Mapping data onto 1-10 score Angila Albaros Regression problem Param Priya Singh linear and non linear regression in 3D ! René Capell Layers in graphs Yasir Kaheil Insurance review statistical methods Thomas Fröjd Layers in graphs Anne-Marie Ternes tryCatch - return from function to main script jim holtman Assoociative array? Daniel Malter modeling binary response variables tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Uwe Ligges Function to create variables with prefix jim holtman long data frame selection error cmr.Pent at gmail.com enscript states file for R scripts? Dennis Fisher Odd behavior of remove command Ivar Herfindal Supressing printing from a function: ecdf Mark Difford meaning of tests presented in anova(ols(...)) {Design package} Hadley Wickham enscript states file for R scripts? Brian Ripley Supressing printing from a function: ecdf Brian Ripley Proxy again, this time on a Mac Patrick Burns Supressing printing from a function: ecdf tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Brian Ripley position of a specific character LostInTimeAndSpace Proxy again, this time on a Mac

Monday, July 14, 2008 110 emails

Sunday, July 13, 2008 52 emails

Saturday, July 12, 2008 61 emails

Friday, July 11, 2008 77 emails

Johannes Hüsing Another packaging question Miklos Kiss Another failed attempt to install an R package in Ubuntu Michael Lawrence Lattice: merged strips? Charles C. Berry More compact form of lm object that can be used for prediction? Daniel Malter data summarization etc... Daniel Malter data summarization etc... Deepayan Sarkar Lattice: merged strips? John C Frain Start preferred RGui ajay ohri data summerization etc... sj data summarization etc... sj data summerization etc... Wolfgang Huber Subsetting an array by a vector of dimensions Kenn Konstabel Subsetting an array by a vector of dimensions Wolfgang Huber Subsetting an array by a vector of dimensions Marc Schwartz More compact form of lm object that can be used for prediction? Rajasekaramya List help theBenjamin Plot multiple datasets on a VCD ternary graph Jorge Ivan Velez List help Erik Iverson Help with error in "if then" statement Henrique Dallazuanna List help Rajasekaramya List help stoffer@pitt.edu Comparing complex numbers Woolner, Keith More compact form of lm object that can be used for prediction? jim holtman plotting granular data jim holtman Difficultes with grep Neil Gupta plotting granular data Jim Porzak odfWeave problem in 7.1? Richard Pearson Subsetting an array by a vector of dimensions Fran100681 Difficultes with grep Henrique Dallazuanna While loop Spencer Graves R bug in the update of nlme? Brad McNeney Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? Bert Gunter reading in a subset of a large data set Rheannon While loop jim holtman reading in a subset of a large data set Duncan Murdoch Comparing complex numbers Andrew Rominger Help with error in "if then" statement hpdutra GroupedData for three way randomized block. LME Richard Pearson Subsetting an array by a vector of dimensions Stacey Burrows reading in a subset of a large data set Thaden, John J Position in a vector of the last value > n - *SOLVED* Marc Schwartz More compact form of lm object that can be used for prediction? Amit Ganatra Ellipsis arguments for plot.formula Patrick Burns Subsetting an array by a vector of dimensions stoffer@pitt.edu Comparing complex numbers Woolner, Keith More compact form of lm object that can be used for prediction? Erin Hodgess mpirun question with Rmpi maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Erik Iverson Meaning of Positive LogLikelihood Richard Pearson Subsetting an array by a vector of dimensions Gundala Viswanath Meaning of Positive LogLikelihood Gabor Grothendieck Ellipsis arguments for plot.formula Amit Ganatra Ellipsis arguments for plot.formula Gábor Csárdi network Dry, Jonathan R network Ptit_Bleu Start preferred RGui Shuhua Zhan modified ks.test? Gábor Csárdi network Keith Jewell Start preferred RGui Gábor Csárdi network Gabor Grothendieck Ellipsis arguments for plot.formula Dry, Jonathan R network Amit Ganatra Ellipsis arguments for plot.formula Bart Joosen Start preferred RGui Januarius Funnel plots Ptit_Bleu Start preferred RGui Gabor Grothendieck Manipulate Data (with regular expressions) Gabor Grothendieck Start preferred RGui Keith Jewell Start preferred RGui Gabor Grothendieck shifting data in matrix by n rows Januarius Funnel plots in r Kenn Konstabel Manipulate Data (with regular expressions) domenico pestalozzi how to test this multivariate normal distribution? marciarr Start preferred RGui Jim Lemon rounding Kunzler, Andreas Manipulate Data (with regular expressions) muhammad faisal Any R package about COALESCENT THEORY/GENEOLOGICAL TREES??

Thursday, July 10, 2008 114 emails

Dieter Menne odfWeave problem in 7.1? ctu at bigred.unl.edu How to output 0.405852702657738 as 0.405853 ? Daren Tan How to output 0.405852702657738 as 0.405853 ? Charles C. Berry number of effective tests Daniel Malter number of effective tests Moshe Olshansky number of effective tests jim holtman Position in a vector of the last value > n jim holtman rounding Martin Morgan embarrassingly parallel problem - simple loop solution Georg Ehret number of effective tests Rolf Turner Problems with Package Installation. Erik Iverson Problems with Package Installation. Moshe Olshansky rounding Sam Albers Problems with Package Installation. Moshe Olshansky rounding Marc Schwartz search with help.start ctu at bigred.unl.edu rounding Bert Gunter princomp loading help Daniel Malter princomp loading help Wu, Hong-Sheng princomp loading help DaveFrisch Interpretation of EXACT Statistical Test in finding the rcoder shifting data in matrix by n rows Jim Porzak odfWeave problem in 7.1? Bert Gunter Ellipsis arguments for plot.formula Susana Esteves R bug in the update of nlme? Jim Porzak odfWeave problem in 7.1? Hadley Wickham layout is to xyplot as ??? is to qplot Gabor Grothendieck shifting data in matrix by n rows (Ted Harding) Interpretation of EXACT Statistical Test in finding the Gabor Grothendieck shifting data in matrix by n rows Rolf Turner rounding Shirin Safa predict.garch problem DaveFrisch Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP) Jim Price layout is to xyplot as ??? is to qplot Korn, Ed (NIH/NCI) [E] rounding Mariana Gamb RE volution rcoder shifting data in matrix by n rows Luke Tierney compiling pnmath on an intel processor running mac OS 10.5 Spencer Graves Operator overloading Amit Ganatra Ellipsis arguments for plot.formula Bert Gunter Sorting a matrix Carlisle Thacker search with help.start Erik Iverson Sorting a matrix (Ted Harding) What's the T-Value in fisher.test Jorge Ivan Velez Sorting a matrix Michael Lawrence compiling pnmath on an intel processor running mac OS 10.5 Ben Bolker xYplot customizing y-axis scaling Angelo Scozzarella Sorting a matrix Ben Bolker xYplot customizing y-axis scaling Hyunseung Kang Help on Installing Matrix Package in Linux (Fedora) Luke Tierney Parallel R Christoph Meyer xYplot customizing y-axis scaling ctu at bigred.unl.edu What's the T-Value in fisher.test Peter Dalgaard What's the T-Value in fisher.test Lyman, Mark Rmpi unkown input format error Hadley Wickham Non-normal data issues in PhD software engineering experiment Chris Gaiteri embarrassingly parallel problem - simple loop solution DaveFrisch What's the T-Value in fisher.test Gustaf Rydevik Non-normal data issues in PhD software engineering experiment Martin Morgan S4 class questions Russell Ivory by() function doesn't work inside another function Martin Morgan Parallel R Daniel Malter Non-normal data issues in PhD software engineering experiment Li, Xuejun S4 class questions Nicole Krämer ppls: version 1.02 including a new data set Birgitle ace error because of missings? Andrew Jackson Non-normal data issues in PhD software engineering experiment Michael Lawrence Lattice: merged strips? Daren Tan How to check how much memory has been used or reserved ? john seers (IFR) false discovery rate ! A Ezhil false discovery rate ! Henning Wildhagen xYplot customizing y-axis scaling Michael Lawrence Interpolation of data Don MacQueen Interpolation of data andrewjacksonTCD Non-normal data issues in PhD software engineering experiment Gabor Grothendieck matplot help Ben Bolker rbinom for a matrix stephen sefick Interpolation of data Michael Rennie Issue with postscript figures using WinAnsi encoding Henrique Dallazuanna Position in a vector of the last value > n Michael Rennie matplot help VinceD build matrix with the content of one column of a data frame in function of two factors Peter Dalgaard Operator overloading Hadley Wickham Operator overloading Thaden, John J Position in a vector of the last value > n Zroutik Zroutik Turn any vector Javier Garcia-Pintado Turn any vector jim holtman Turn any vector Gábor Csárdi Turn any vector Henrique Dallazuanna Turn any vector Zroutik Zroutik Turn any vector Leandro Marino Bootstrap in betareg() alessia matano problems with rq.fit.sfn Rainer M Krug version problems of rkward in ubuntu hardy repository Roger Koenker quantile regression estimation results Jim Lemon Grid building in R PIKAL Petr Odp: specifying data Emili Tortosa-Ausina quantile regression estimation results Daniel Malter Interpolation of data Tobias Verbeke Sorting / editing a table Daniel Malter specifying data Daniel Malter Sorting / editing a table Wacek Kusnierczyk Sorting / editing a table Jörg Groß Sorting / editing a table mysimbaa Plot depends on conditions PIKAL Petr Thanks! Peter Dalgaard Operator overloading Schleuh re ad.table problem alessia matano problems with rq.fit.sfn Briantgr Problem when building a test R package on PC Tine Operator overloading Paolo Sonego Parsing Peter Dalgaard “Check” problem Tobias Verbeke childNames for xaxis grob (grid package)

Wednesday, July 9, 2008 161 emails

Tuesday, July 8, 2008 123 emails

Monday, July 7, 2008 110 emails

Peng Jiang Sum(Random Numbers)=100 Shubha Vishwanath Karanth Sum(Random Numbers)=100 Moshe Olshansky Sum(Random Numbers)=100 Daren Tan Can R do this ? Shubha Vishwanath Karanth Sum(Random Numbers)=100 Charles C. Berry odd dnorm behaviour (?) Moshe Olshansky odd dnorm behaviour (?) Martin Morgan list genes w/n a genomic fragment Michael Lawrence odd dnorm behaviour (?) Michael Lawrence odd dnorm behaviour (?) Bert Gunter list genes w/n a genomic fragment Johannes Hüsing Interpreting messages when building packages runner list genes w/n a genomic fragment jim holtman Basic Vector and Matrix Operations DS question on lm or glm matrix of coeficients X test data terms DS question on lm or glm matrix of coeficients X test data terms Daniel Malter Problems with lm() Chibisi Chima-Okereke Problems with lm() Jorge Ivan Velez question on lm or glm matrix of coeficients X test data terms DS question on lm or glm matrix of coeficients X test data terms Daniel Malter GLM, LMER, GEE interpretation Moshe Olshansky multiplication question Farley, Robert Survey questions Achim Zeileis Drawing a colour wheel - bug in hcl? Hadley Wickham Drawing a colour wheel - bug in hcl? Ben Bolker GLM, LMER, GEE interpretation Hadley Wickham Drawing a colour wheel - bug in hcl? Peter Dalgaard Interest in a Use R Group in San Francisco area? Achim Zeileis Drawing a colour wheel - bug in hcl? Earl F. Glynn Drawing a colour wheel - bug in hcl? Erik Iverson Basic Vector and Matrix Operations Daniel Malter GLM, LMER, GEE interpretation Jorge Ivan Velez Basic Vector and Matrix Operations apjaworski@mmm.com Basic Vector and Matrix Operations Xiaohui Chen Basic Vector and Matrix Operations Eric Turkheimer Basic Vector and Matrix Operations John Kane indicating significant differences in boxplots Johannes Hüsing Interpreting messages when building packages Duncan Murdoch Interpreting messages when building packages Marc Schwartz Interest in a Use R Group in San Francisco area? Hadley Wickham Colour clusters in a 2d plot Hadley Wickham Drawing a colour wheel - bug in hcl? Johannes Hüsing Interpreting messages when building packages Peter Dalgaard subset() multiple arguments Peter Dalgaard Interest in a Use R Group in San Francisco area? Duncan Murdoch subset() multiple arguments Henrique Dallazuanna subset() multiple arguments Duncan Murdoch Interpreting messages when building packages stephen sefick subset() multiple arguments Johannes Hüsing Interpreting messages when building packages Marc Schwartz Interest in a Use R Group in San Francisco area? Jim Porzak Interest in a Use R Group in San Francisco area? ctu at bigred.unl.edu GLM, LMER, GEE interpretation Jorge Ivan Velez Colour clusters in a 2d plot Peter Dalgaard A shorter version of ".Last.value"? Peter Dalgaard A shorter version of ".Last.value"? Gabor Grothendieck A shorter version of ".Last.value"? Earl F. Glynn Drawing a colour wheel - bug in hcl? Jon Zadra A shorter version of ".Last.value"? Josep Maria Campanera Alsina Colour clusters in a 2d plot Ben Bolker GLM, LMER, GEE interpretation Terry Therneau Relative Mortality Risk second part Ben Bolker Running "all possible subsets" of a GLM (binomial) model Hadley Wickham Running "all possible subsets" of a GLM (binomial) model Frank E Harrell Jr Method for checking automatically which distribtions fits a data jim holtman Plot depends on conditions David Reinke Method for checking automatically which distribtions fits a data Greg Snow L1 nonlinear approximation Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Hadley Wickham Drawing a colour wheel - bug in hcl? Paul Gilbert Exception Handling Eric Vander Wal Running "all possible subsets" of a GLM (binomial) model Hadley Wickham Method for checking automatically which distribtions fits a data mysimbaa Plot depends on conditions (Ted Harding) A quick question about lm() ONKELINX, Thierry A quick question about lm() Tobias Verbeke A quick question about lm() (Ted Harding) A quick question about lm() Henrique Dallazuanna A quick question about lm() Ben Bolker Hi~problem with the two sample test: ks2Test in the package of fbasics J S Test for multiple comparisons: Nonlinear model, autocorrelation? Ben Bolker Method for checking automatically which distribtions fits a data rlearner309 A quick question about lm() John Fox Change language in Rcmdr Terry Therneau cross-validation in rpart milton ruser Sorting a list Peter Dalgaard Sorting a list Nutter, Benjamin Bland-Altman method to measure agreement with repeated measures jim holtman Exception Handling tolga.i.uzuner at jpmorgan.com Sorting a list Jim Lemon indicating significant differences in boxplots Philippe GROSJEAN Change language in Rcmdr Gabor Grothendieck Error in defining function Duncan Murdoch Change language in Rcmdr Thomas Frööjd RES: Need ideas on how to show spikes in my data and how to codeit in R Gundala Viswanath Howto Initialize Parameter of Gamma Mixture Densities for EM ONKELINX, Thierry How can I optimize this piece of code ? Paulo Cardoso spatial statistics and matrix algebra Sebastian Merz indicating significant differences in boxplots Daren Tan How can I optimize this piece of code ? Thiemo Schreiber one-site competition data // curve fitting Thibaut Jombart How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Schleuh Change language in Rcmdr Lauri Nikkinen Hmisc latex: table column width Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Daniel Malter GLM, LMER, GEE interpretation Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Megh Dal Error in defining function Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Satoshi Takahama Method for checking automatically which distribtions fits a data

Sunday, July 6, 2008 72 emails

Satoshi Takahama Plot Mixtures of Synthetically Generated Gamma Distributions Moshe Olshansky Plot Mixtures of Synthetically Generated Gamma Distributions l y Hi~problem with the two sample test: ks2Test in the package of fbasics Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Gundala Viswanath Plot Mixtures of Synthetically Generated Gamma Distributions Paul Murrell Backgrounds in Multiple Plots made with "fig" Gabor Grothendieck Error in defining function Dirk Eddelbuettel How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Spencer Graves Functional Data Analysis, fda_1.2.4 Megh Dal Error in defining function ctu at bigred.unl.edu Method for checking automatically which distribtions fits a data Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Moshe Olshansky Lots of huge matrices, for-loops, speed Duncan Murdoch Regular expressions: bug or misunderstanding? Gundala Viswanath Method for checking automatically which distribtions fits a data Mark Leeds Numbers as Points in Graphs Rolf Turner Lots of huge matrices, for-loops, speed Gabor Grothendieck Regular expressions: bug or misunderstanding? Tudor Bodea Exception Handling Hua Li color with tcl/tk? Sam Albers Numbers as Points in Graphs Duncan Murdoch Regular expressions: bug or misunderstanding? Hua Li ignore warning messages? (Ted Harding) Numbers as Points in Graphs milton ruser Numbers as Points in Graphs Moshe Olshansky Lots of huge matrices, for-loops, speed Mark Leeds Numbers as Points in Graphs Sam Albers Numbers as Points in Graphs milton ruser Numbers as Points in Graphs Hadley Wickham What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Sam Albers Numbers as Points in Graphs Michael Rennie Issue with postscript figures using WinAnsi encoding Michael Rennie Issue with postscript figures using WinAnsi encoding (Ted Harding) Regular expressions: bug or misunderstanding? Gabor Grothendieck Regular expressions: bug or misunderstanding? Duncan Murdoch Regular expressions: bug or misunderstanding? Gabor Grothendieck ts.plot Ray Brownrigg Lots of huge matrices, for-loops, speed Imanpreet Benchmarking R and R Workloads jim holtman Lots of huge matrices, for-loops, speed Gabor Grothendieck Error in defining function threshold ts.plot ctu at bigred.unl.edu looking for alternative of 'if-else' Megh Dal Error in defining function hpdutra What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Duncan Murdoch looking for alternative of 'if-else' Lily Hi~problem with the two sample test: ks2Test in the package of fbasics Arun Kumar Saha looking for alternative of 'if-else' Zarza Lots of huge matrices, for-loops, speed Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Duncan Murdoch Windows Only: winMenuAdd() problem Bernardo Rangel Tura Ignore blank columns when reading a row from a table Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Bert Gunter Windows Only: winMenuAdd() problem Tom La Bone Backgrounds in Multiple Plots made with "fig" Hadley Wickham Repeated measures lme or anova Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Duncan Murdoch Interpreting messages when building packages Johannes Hüsing Interpreting messages when building packages Martin Henry H. Stevens Repeated measures lme or anova Martin Henry H. Stevens {spam?} Re: Error: cannot use PQL when using lmer Gavin Simpson lattice smooth problem? Troels Ring lattice smooth problem? Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? (Ted Harding) help about random generation of a Normal distribution of ctu at bigred.unl.edu looking for alternative of 'if-else' Duncan Murdoch looking for alternative of 'if-else' Felix Andrews lattice question Arun Kumar Saha looking for alternative of 'if-else' Brian Ripley Different Autocorrelation using R and other softwares

Saturday, July 5, 2008 36 emails

hpdutra Error: cannot use PQL when using lmer hpdutra interpreting mixed model anova results Edwin Lei trying to superimpose a line plot onto a histogram Mark Leeds lattice question Bill Venables help about random generation of a Normal distribution ofseveral variables Bill Venables help about random generation of a Normal distribution ofseveral variables Yinny Different Autocorrelation using R and other softwares Edwin Lei trying to superimpose a line plot onto a histogram Peng Jiang help about random generation of a Normal distribution of several variables hpdutra at yahoo.com Error: cannot use PQL when using lmer Ben Bolker Error: cannot use PQL when using lmer hpdutra at yahoo.com Error: cannot use PQL when using lmer Brooke LaFlamme interpreting mixed model anova results Daniel Stahl Problem solved: extracting values from a "by" function Daniel Stahl extracting values from a "by" function Brian Lunergan using texmacs as front for R on windows xp sp2... Edwin Lei trying to superimpose a line plot onto a histogram Philippe GROSJEAN SciViews GUI David Katz Random Forest %var(y) Felipe Carrillo SciViews GUI (Ted Harding) help about random generation of a Normal distribution of Gavin Simpson help about random generation of a Normal distribution of several variables Marc Schwartz Bland-Altman method to measure agreement with repeated measures Peng Jiang help about random generation of a Normal distribution of several variables Arnau Mir Torres help about random generation of a Normal distribution of several variables Arnau Mir Torres help about random generation of a Normal distribution of several variables milton ruser trying to superimpose a line plot onto a histogram J S Test for multiple comparisons: Nonlinear model, autocorrelation? John Fox set type of SS in anova() Gavin Simpson p-value for Nonmetric Multidimentional Scaling? Ulrich Leopold update search path for attached data kende jan Bland-Altman method to measure agreement with repeated measures Troels Ring lattice smooth Edwin Lei trying to superimpose a line plot onto a histogram Brian Ripley synthax for R CMD INSTALL Brian Ripley set type of SS in anova()

Friday, July 4, 2008 38 emails

Bill Venables p-value for Nonmetric Multidimentional Scaling? Michael Denslow p-value for Nonmetric Multidimentional Scaling? Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Naiara Pinto synthax for R CMD INSTALL Jeroen Ooms set type of SS in anova() Frank E Harrell Jr logistic regreesion and score test 刘杰 logistic regreesion and score test jim holtman Calling and running a compiled program inside R jim holtman create a zero matrix & fill Leandro Marino RES: Error while plotting matrix Leandro Marino RES: initialize a matrix mysimbaa Error while plotting matrix Brian Ripley Re ad in a file - produce independent vectors Marc Schwartz Re ad in a file - produce independent vectors Paek, Insu Calling and running a compiled program inside R PIKAL Petr Odp: Re ad in a file - produce independent vectors Gabor Grothendieck Re ad in a file - produce independent vectors jimineep Re ad in a file - produce independent vectors mysimbaa initialize a matrix Brian Ripley update search path for attached data Ulrich Leopold update search path for attached data mysimbaa initialize a matrix J S Test for multiple comparisons: Nonlinear model, autocorrelation? John Coulthard Repeated measures lme or anova Anders Malmendal test for difference in variance Duncan Murdoch stop without error message tolga.i.uzuner at jpmorgan.com Problem with strucchange package Keld J?rn Simonsen problem with NA and if Eric Ferreira stop without error message Daren Tan passing arguments to a R script Lauri Nikkinen Hmisc latex: table column width Peter Dalgaard Exporting a Graph that has lines() Paul Hiemstra kriging problem(?) Brian Ripley Problem in installing Biobase Gavin Simpson apply with a division Jason Lee Problem in installing Biobase robert.ptacnik at niva.no kriging problem(?) Bill Venables problem with NA and if

Thursday, July 3, 2008 150 emails

Wednesday, July 2, 2008 140 emails

Tuesday, July 1, 2008 135 emails

Monday, June 30, 2008 7 emails

Rolf Turner Messge ``no visible binding''. Peng Jiang Mclust ??? Jason Lee Help in using PCR Ben Bolker Coda not providing summary on mcmc object Rolf Turner lm and NA Peter Alspach lm and NA Rolf Turner Add comments on plot window

R-help July 2008