Skip to content

R-help July 2008

|

(Ted Harding)

Last active: Jul 30, 2008
37 msgs
(Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008 (Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008 (Ted Harding) How do I paste double quotes arround a character string? Jul 3, 2008 (Ted Harding) help about random generation of a Normal distribution of Jul 5, 2008 (Ted Harding) help about random generation of a Normal distribution of Jul 6, 2008 (Ted Harding) Regular expressions: bug or misunderstanding? Jul 6, 2008 (Ted Harding) Numbers as Points in Graphs Jul 6, 2008 (Ted Harding) A quick question about lm() Jul 7, 2008 (Ted Harding) A quick question about lm() Jul 7, 2008 (Ted Harding) Question: Beginner stuck in a R cycle Jul 8, 2008 (Ted Harding) gsub and "\" Jul 9, 2008 (Ted Harding) What's the T-Value in fisher.test Jul 10, 2008 (Ted Harding) Interpretation of EXACT Statistical Test in finding the Jul 10, 2008 (Ted Harding) shapiro wilk normality test Jul 13, 2008 (Ted Harding) shapiro wilk normality test Jul 13, 2008 (Ted Harding) shapiro wilk normality test Jul 13, 2008 (Ted Harding) shapiro wilk normality test Jul 13, 2008 (Ted Harding) Labelling curves on graphs Jul 16, 2008 (Ted Harding) Labelling curves on graphs Jul 16, 2008 (Ted Harding) Labelling curves on graphs Jul 17, 2008 (Ted Harding) Title for graph with multiple plots Jul 19, 2008 (Ted Harding) Order of columns(variables) in dataframe Jul 20, 2008 (Ted Harding) Getting plot axes where they should be! Jul 21, 2008 (Ted Harding) Getting plot axes where they should be! Jul 21, 2008 (Ted Harding) Getting plot axes where they should be! Jul 21, 2008 (Ted Harding) Coefficients of Logistic Regression from bootstrap - how Jul 21, 2008 (Ted Harding) Simple... but... Jul 23, 2008 (Ted Harding) What is wrong with this contrast matrix? Jul 24, 2008 (Ted Harding) Help with which() Jul 24, 2008 (Ted Harding) Should this PDF render correctly without font embedding? Jul 24, 2008 (Ted Harding) Numerical question Jul 25, 2008 (Ted Harding) Sample Jul 26, 2008 (Ted Harding) Converting english words to numeric equivalents Jul 28, 2008 (Ted Harding) Case statements in R Jul 28, 2008 (Ted Harding) was: Re: Legality Question about R's Open Source GNU GPL License Jul 28, 2008 (Ted Harding) table questions Jul 29, 2008 (Ted Harding) R -Legality Question about R's Open Source GNU GPL Licen Jul 30, 2008

A Ezhil

Last active: Jul 15, 2008
3 msgs
A Ezhil false discovery rate ! Jul 10, 2008 A Ezhil Problem installing R on openSUSE 10.3 Jul 15, 2008 A Ezhil Problem installing R on openSUSE 10.3 Jul 15, 2008

ACroske

Last active: Jul 18, 2008
5 msgs
ACroske rbinom for a matrix Jul 9, 2008 ACroske rbinom for a matrix Jul 9, 2008 ACroske rbinom for a matrix Jul 9, 2008 ACroske "Spreading risk" in a matrix Jul 18, 2008 ACroske "Spreading risk" in a matrix Jul 18, 2008

Abhijit Dasgupta

Last active: Jul 21, 2008
3 msgs
Abhijit Dasgupta get formatted regression output Jul 2, 2008 Abhijit Dasgupta apply with a division Jul 3, 2008 Abhijit Dasgupta Output Nicely formatted tables from R Jul 21, 2008

Abiel Reinhart

Last active: Jul 23, 2008
1 msg
Abiel Reinhart Aggregating zoo object with NAs in multiple column Jul 23, 2008

Achim Zeileis

Last active: Jul 25, 2008
9 msgs
Achim Zeileis Problem with strucchange package Jul 2, 2008 Achim Zeileis as.Date() clarification Jul 3, 2008 Achim Zeileis Drawing a colour wheel - bug in hcl? Jul 7, 2008 Achim Zeileis Drawing a colour wheel - bug in hcl? Jul 7, 2008 Achim Zeileis CART and CHAID Jul 21, 2008 Achim Zeileis rollmean and stl Jul 22, 2008 Achim Zeileis Time series reliability questions Jul 23, 2008 Achim Zeileis Aggregating zoo object with NAs in multiple column Jul 23, 2008 Achim Zeileis Rolling range and regression calculations Jul 25, 2008

Adam B. Thompson

Last active: Jul 14, 2008
1 msg
Adam B. Thompson swap_tail macro in pnorm.c Jul 14, 2008

Adam Langley

Last active: Jul 30, 2008
2 msgs
Adam Langley High resolution graphics from Windows Vista Jul 30, 2008 Adam Langley High resolution graphics from R Windows Vista Jul 30, 2008

Adrian Dusa

Last active: Jul 8, 2008
1 msg
Adrian Dusa Change language in Rcmdr Jul 8, 2008

Agus Susanto

Last active: Jul 31, 2008
1 msg
Agus Susanto multiple comparison Jul 31, 2008

Agustin Lobo

Last active: Jul 28, 2008
2 msgs
Agustin Lobo Recoding Jul 3, 2008 Agustin Lobo Converting from char to POSIX: Jul 28, 2008

Aiste Aistike

Last active: Jul 31, 2008
3 msgs
Aiste Aistike Question about the SSOAP package Jul 28, 2008 Aiste Aistike How to output R image to a file? Jul 31, 2008 Aiste Aistike How to output R image to a file? Jul 31, 2008

Alan Cox

Last active: Jul 31, 2008
2 msgs
Alan Cox Help with hazard plots Jul 31, 2008 Alan Cox Help with hazard plots Jul 31, 2008

Alan Kelly

Last active: Jul 8, 2008
1 msg
Alan Kelly package segmented problem Jul 8, 2008

Alan Spearot

Last active: Jul 24, 2008
3 msgs
Alan Spearot Large number of dummy variables Jul 21, 2008 Alan Spearot Large number of dummy variables Jul 21, 2008 Alan Spearot Parallel Processing and Linear Regression Jul 24, 2008

Alan Swanson

Last active: Jul 30, 2008
1 msg
Alan Swanson best quad core configuration? Jul 30, 2008

Albert Greinoecker

Last active: Jul 3, 2008
1 msg
Albert Greinoecker problem with NA and if Jul 3, 2008

Albin Blaschka

Last active: Jul 23, 2008
4 msgs
Albin Blaschka Change font-face in title Jul 18, 2008 Albin Blaschka Change font-face in title Jul 19, 2008 Albin Blaschka Change font-face in title Jul 19, 2008 Albin Blaschka Using RODBC to use SQL queries Jul 23, 2008

Alessandro

Last active: Jul 31, 2008
11 msgs
Alessandro gstat problem with lidar data Jul 16, 2008 Alessandro R: R: gstat problem with lidar data Jul 16, 2008 Alessandro experimental semivariogram Jul 21, 2008 Alessandro create multi windows plot at the same time Jul 25, 2008 Alessandro R: create multi windows plot at the same time Jul 25, 2008 Alessandro "wave model" semivariogram Jul 28, 2008 Alessandro Flexible semivariogram in R (HELP) Jul 29, 2008 Alessandro Random subset Jul 30, 2008 Alessandro question about krige code in R Jul 30, 2008 Alessandro anisotrophy in fit.variogram problem Jul 31, 2008 Alessandro anisotropy in vgm model. HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Jul 31, 2008

Alfredo Alessandrini

Last active: Jul 31, 2008
1 msg
Alfredo Alessandrini add string Jul 31, 2008

Allan Clark

Last active: Jul 8, 2008
1 msg
Allan Clark nls and "plinear" algorithm Jul 8, 2008

Alphonse Monkamg

Last active: Jul 25, 2008
1 msg
Alphonse Monkamg pca Jul 25, 2008

Amin Momin

Last active: Jul 29, 2008
1 msg
Amin Momin Panel of pie charts Jul 29, 2008

Amine Mohamed ROUANE HACENE

Last active: Jul 2, 2008
2 msgs
Amine Mohamed ROUANE HACENE Extracting regression coef. and p-values in JRClient Jul 2, 2008 Amine Mohamed ROUANE HACENE Extracting regression coef. and p-values in JRClient Jul 2, 2008

Amit Ganatra

Last active: Jul 11, 2008
4 msgs
Amit Ganatra Ellipsis arguments for plot.formula Jul 10, 2008 Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008 Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008 Amit Ganatra Ellipsis arguments for plot.formula Jul 11, 2008

Anders Malmendal

Last active: Jul 4, 2008
1 msg
Anders Malmendal test for difference in variance Jul 4, 2008

Andre Cesta

Last active: Jul 30, 2008
2 msgs
Andre Cesta Successfully connected GNU R to PostgreSQL on windows XP. Jul 30, 2008 Andre Cesta Connecting R to PostgreSQL on Windows. Jul 30, 2008

Andreas Tille

Last active: Jul 28, 2008
7 msgs
Andreas Tille Matrix barplot Jul 25, 2008 Andreas Tille Matrix barplot Jul 25, 2008 Andreas Tille Matrix barplot Jul 25, 2008 Andreas Tille Matrix barplot Jul 25, 2008 Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 26, 2008 Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 27, 2008 Andreas Tille Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008

Andrew Jackson

Last active: Jul 10, 2008
1 msg
Andrew Jackson Non-normal data issues in PhD software engineering experiment Jul 10, 2008

Andrew Redd

Last active: Jul 28, 2008
2 msgs
Andrew Redd Rf_error crashes entire program. Jul 28, 2008 Andrew Redd Rf_error crashes entire program. Jul 28, 2008

Andrew Robinson

Last active: Jul 3, 2008
1 msg
Andrew Robinson problem with NA and if Jul 3, 2008

Andrew Rominger

Last active: Jul 11, 2008
1 msg
Andrew Rominger Help with error in "if then" statement Jul 11, 2008

Andrew Yee

Last active: Jul 21, 2008
2 msgs
Andrew Yee with lapply() how can you retrieve the name of the object Jul 18, 2008 Andrew Yee with lapply() how can you retrieve the name of the object Jul 21, 2008

Andrewjohnclose

Last active: Jul 30, 2008
1 msg
Andrewjohnclose Re creating Procrustes Plot in Lattice Jul 30, 2008

Angel Spassov

Last active: Jul 3, 2008
1 msg
Angel Spassov 'as.Date' conversion of classes POSIX*t (problem/feature)? Jul 3, 2008

Angelo Scozzarella

Last active: Jul 23, 2008
7 msgs
Angelo Scozzarella Sorting a matrix Jul 10, 2008 Angelo Scozzarella Editor fpr Mac OS Jul 21, 2008 Angelo Scozzarella Editor for Mac Jul 22, 2008 Angelo Scozzarella Function Error Jul 22, 2008 Angelo Scozzarella TextMate and R Jul 22, 2008 Angelo Scozzarella Histogram Jul 23, 2008 Angelo Scozzarella Point-biserial correlation Jul 23, 2008

Angila Albaros

Last active: Jul 16, 2008
2 msgs
Angila Albaros Regression problem Jul 15, 2008 Angila Albaros Regression problem Jul 16, 2008

Anna Radtke

Last active: Jul 25, 2008
2 msgs
Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors Jul 25, 2008 Anna Radtke glht after lmer with "$S4class-" and "missing model.matrix-" errors with DATA Jul 25, 2008

Anne-Marie Ternes

Last active: Jul 15, 2008
5 msgs
Anne-Marie Ternes position legend below x-axis title Jul 2, 2008 Anne-Marie Ternes Sweave / Latex per-chapter output Jul 2, 2008 Anne-Marie Ternes recursively divide a value to get a sequence Jul 9, 2008 Anne-Marie Ternes recursively divide a value to get a sequence Jul 9, 2008 Anne-Marie Ternes tryCatch - return from function to main script Jul 15, 2008

Antje

Last active: Jul 18, 2008
5 msgs
Antje name returned by lapply Jul 18, 2008 Antje name returned by lapply Jul 18, 2008 Antje generate repeats of a vector's elements Jul 18, 2008 Antje name returned by lapply Jul 18, 2008 Antje name returned by lapply Jul 18, 2008

Arnau Mir Torres

Last active: Jul 5, 2008
2 msgs
Arnau Mir Torres help about random generation of a Normal distribution of several variables Jul 5, 2008 Arnau Mir Torres help about random generation of a Normal distribution of several variables Jul 5, 2008

Arne Henningsen

Last active: Jul 3, 2008
2 msgs
Arne Henningsen Tobit Estimation with Panel Data Jul 2, 2008 Arne Henningsen Tobit Estimation with Panel Data Jul 3, 2008

Arthur Roberts

Last active: Jul 28, 2008
6 msgs
Arthur Roberts Integrating R and Textmate Jul 24, 2008 Arthur Roberts Installing R packages in Textmate Jul 24, 2008 Arthur Roberts Bug in gap.plot Jul 24, 2008 Arthur Roberts Are there any packages that can process images other than pixelmap (i.e. pnm)? Jul 27, 2008 Arthur Roberts Is there way to multiple plots on gap.plot? Jul 28, 2008 Arthur Roberts Is there anyway to clip the bottom of a barplot? Jul 28, 2008

Arun Kumar Saha

Last active: Jul 27, 2008
6 msgs
Arun Kumar Saha looking for alternative of 'if-else' Jul 6, 2008 Arun Kumar Saha looking for alternative of 'if-else' Jul 6, 2008 Arun Kumar Saha Weighted variance function? Jul 23, 2008 Arun Kumar Saha Weighted variance function? Jul 27, 2008 Arun Kumar Saha Weighted variance function? Jul 27, 2008 Arun Kumar Saha Weighted variance function? Jul 27, 2008

Ashish Kumar

Last active: Jul 26, 2008
1 msg
Ashish Kumar Transfer Function Modeling Jul 26, 2008

Assaf oron

Last active: Jul 16, 2008
1 msg
Assaf oron Confidence bands for model estimates using ns() spline basis Jul 16, 2008

Austin, Matt

Last active: Jul 24, 2008
3 msgs
Austin, Matt Labelling curves on graphs Jul 16, 2008 Austin, Matt Using PrettyR to produce LaTeX output Jul 23, 2008 Austin, Matt How to preserve the numeric format and digits ? Jul 24, 2008

Ayman Oweida

Last active: Jul 21, 2008
1 msg
Ayman Oweida Using integrate Jul 21, 2008

BXC (Bendix Carstensen)

Last active: Jul 29, 2008
2 msgs
BXC (Bendix Carstensen) competing risk model with time dependent covariates under R or Splus Jul 27, 2008 BXC (Bendix Carstensen) Installing BRugs Jul 29, 2008

Baptiste Auguie

Last active: Jul 28, 2008
6 msgs
Baptiste Auguie ggplot2 legend for vertical lines Jul 3, 2008 Baptiste Auguie melting a list: basic question Jul 25, 2008 Baptiste Auguie melting a list: basic question Jul 25, 2008 Baptiste Auguie melting a list: basic question Jul 26, 2008 Baptiste Auguie Converting english words to numeric equivalents Jul 28, 2008 Baptiste Auguie Converting english words to numeric equivalents Jul 28, 2008

Barry Rowlingson

Last active: Jul 28, 2008
5 msgs
Barry Rowlingson Labelling curves on graphs Jul 16, 2008 Barry Rowlingson Labelling curves on graphs Jul 17, 2008 Barry Rowlingson Table orderd by frequencies Jul 22, 2008 Barry Rowlingson Function Error Jul 22, 2008 Barry Rowlingson Converting english words to numeric equivalents Jul 28, 2008

Bart Joosen

Last active: Jul 30, 2008
5 msgs
Bart Joosen Area Under a Curve Jul 2, 2008 Bart Joosen re cursively divide a value to get a sequence Jul 9, 2008 Bart Joosen Start preferred RGui Jul 11, 2008 Bart Joosen how to speed up this for loop? Jul 22, 2008 Bart Joosen R command history -- can it be like Matlab's? Jul 30, 2008

Beat Huggler

Last active: Jul 30, 2008
1 msg
Beat Huggler Generic plot function for GLM objects Jul 30, 2008

Ben Bolker

Last active: Jul 31, 2008
38 msgs
Ben Bolker Coda not providing summary on mcmc object Jun 30, 2008 Ben Bolker Plotting Bi-Gamma Distribution Jul 2, 2008 Ben Bolker loop calculation Jul 3, 2008 Ben Bolker Error: cannot use PQL when using lmer Jul 5, 2008 Ben Bolker Method for checking automatically which distribtions fits a data Jul 7, 2008 Ben Bolker Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 7, 2008 Ben Bolker Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008 Ben Bolker GLM, LMER, GEE interpretation Jul 7, 2008 Ben Bolker GLM, LMER, GEE interpretation Jul 7, 2008 Ben Bolker Help with eigenvectors Jul 8, 2008 Ben Bolker one-site competition data // curve fitting Jul 8, 2008 Ben Bolker Loglikelihood for x factorial? Jul 9, 2008 Ben Bolker rbinom for a matrix Jul 9, 2008 Ben Bolker rbinom for a matrix Jul 9, 2008 Ben Bolker Port package Jul 9, 2008 Ben Bolker Read.table - Less rows than original data Jul 9, 2008 Ben Bolker rbinom for a matrix Jul 10, 2008 Ben Bolker xYplot customizing y-axis scaling Jul 10, 2008 Ben Bolker xYplot customizing y-axis scaling Jul 10, 2008 Ben Bolker Control parameter of the optim( ): parscale Jul 21, 2008 Ben Bolker Parameter names in nls Jul 22, 2008 Ben Bolker Error in installing packages Jul 22, 2008 Ben Bolker Simple... but... Jul 23, 2008 Ben Bolker Quantitative analysis of non-standard scatter plots. Jul 23, 2008 Ben Bolker Convert list of lists <--> data frame Jul 23, 2008 Ben Bolker Help with which() Jul 24, 2008 Ben Bolker Help with which() Jul 24, 2008 Ben Bolker Maximization under constraits Jul 25, 2008 Ben Bolker issues with gap.plot function Jul 26, 2008 Ben Bolker axis.break on Date-x-axis in lattice xyplot Jul 28, 2008 Ben Bolker Negative Binomial Regression Jul 29, 2008 Ben Bolker Negative Binomial Regression Jul 29, 2008 Ben Bolker Negative Binomial Regression Jul 29, 2008 Ben Bolker adding lines to multiple plot Jul 30, 2008 Ben Bolker adding lines to multiple plot Jul 30, 2008 Ben Bolker Sampling two exponentials Jul 30, 2008 Ben Bolker Sampling two exponentials Jul 31, 2008 Ben Bolker Converting to subscripts and superscripts Jul 31, 2008

Ben Tupper

Last active: Jul 29, 2008
5 msgs
Ben Tupper how do I read only specific columns using read.csv or other read function Jul 2, 2008 Ben Tupper How to extract folowing data? Jul 14, 2008 Ben Tupper Mapping data onto score Jul 15, 2008 Ben Tupper Mapping data onto score Jul 15, 2008 Ben Tupper placing a text in the corner of a plot Jul 29, 2008

Benjamin Otto

Last active: Jul 8, 2008
1 msg
Benjamin Otto workspace platform potabillity Jul 8, 2008

Benno Pütz

Last active: Jul 29, 2008
1 msg
Benno Pütz 'for' loop, two variables Jul 29, 2008

Berend Hasselman

Last active: Jul 25, 2008
2 msgs
Berend Hasselman How to solve systems of nonlinear equations in R? Jul 19, 2008 Berend Hasselman transcript a matlab code in R Jul 25, 2008

Bernardo Rangel Tura

Last active: Jul 20, 2008
3 msgs
Bernardo Rangel Tura Ignore blank columns when reading a row from a table Jul 6, 2008 Bernardo Rangel Tura Resshufling algorithm (Thiago Souza) Jul 19, 2008 Bernardo Rangel Tura calculate differences - strange outcome Jul 20, 2008

Bert Gunter

Last active: Jul 31, 2008
18 msgs
Bert Gunter W-E-I-R-D Weird! Jul 1, 2008 Bert Gunter W-E-I-R-D Weird! Jul 1, 2008 Bert Gunter A regression problem using dummy variables Jul 3, 2008 Bert Gunter Windows Only: winMenuAdd() problem Jul 6, 2008 Bert Gunter list genes w/n a genomic fragment Jul 7, 2008 Bert Gunter Sorting a matrix Jul 10, 2008 Bert Gunter Ellipsis arguments for plot.formula Jul 10, 2008 Bert Gunter princomp loading help Jul 10, 2008 Bert Gunter reading in a subset of a large data set Jul 11, 2008 Bert Gunter What package to use to create a GUI Jul 15, 2008 Bert Gunter Mapping data onto score Jul 16, 2008 Bert Gunter Function to verify existence of an R object Jul 16, 2008 Bert Gunter Hiding information about functions in newly developed packages Jul 17, 2008 Bert Gunter Large number of dummy variables Jul 21, 2008 Bert Gunter Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Bert Gunter Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008 Bert Gunter Fill in NA values in vector with previous character/factor Jul 28, 2008 Bert Gunter Storing Matrices into Hash Jul 31, 2008

Berwin A Turlach

Last active: Jul 23, 2008
8 msgs
Berwin A Turlach recursively divide a value to get a sequence Jul 9, 2008 Berwin A Turlach shapiro wilk normality test Jul 13, 2008 Berwin A Turlach NAMESPACE vs internal.Rd Jul 16, 2008 Berwin A Turlach NAMESPACE vs internal.Rd Jul 16, 2008 Berwin A Turlach calculate differences - strange outcome Jul 17, 2008 Berwin A Turlach NAMESPACE vs internal.Rd Jul 17, 2008 Berwin A Turlach Simple... but... Jul 23, 2008 Berwin A Turlach truncated normal Jul 23, 2008

Bill Cunliffe

Last active: Jul 21, 2008
2 msgs
Bill Cunliffe Output Nicely formatted tables from R Jul 21, 2008 Bill Cunliffe y-axis number format on plot, barplot etc. Jul 21, 2008

Bill Venables

Last active: Jul 30, 2008
10 msgs
Bill Venables problem with NA and if Jul 4, 2008 Bill Venables p-value for Nonmetric Multidimentional Scaling? Jul 4, 2008 Bill Venables help about random generation of a Normal distribution ofseveral variables Jul 5, 2008 Bill Venables help about random generation of a Normal distribution ofseveral variables Jul 5, 2008 Bill Venables Sum(Random Numbers)=100 Jul 8, 2008 Bill Venables function "eigen" AND Minitab Jul 18, 2008 Bill Venables GLS "no terms component" error Jul 26, 2008 Bill Venables Help interpreting density(). Jul 28, 2008 Bill Venables Help interpreting density(). Jul 29, 2008 Bill Venables barplot for a categorial variable Jul 30, 2008

Bio7

Last active: Jul 3, 2008
3 msgs
Bio7 PCA on image data Jul 3, 2008 Bio7 PCA on image data Jul 3, 2008 Bio7 PCA on image data Jul 3, 2008

Birgit Lemcke

Last active: Jul 16, 2008
2 msgs
Birgit Lemcke randomForest outlier Jul 16, 2008 Birgit Lemcke randomForest outlier Jul 16, 2008

Birgitle

Last active: Jul 31, 2008
7 msgs
Birgitle problems using mice() Jul 9, 2008 Birgitle ace error because of missings? Jul 10, 2008 Birgitle randomForest outlier Jul 15, 2008 Birgitle problem with read.table() Jul 30, 2008 Birgitle problem with read.table() Jul 30, 2008 Birgitle glm error: factor levels Jul 30, 2008 Birgitle Sperman Correlation with rcorr (Hmisc) Jul 31, 2008

Bjørn-Helge Mevik

Last active: Jul 2, 2008
3 msgs
Bjørn-Helge Mevik Help in using PCR Jul 1, 2008 Bjørn-Helge Mevik Help in using PCR Jul 2, 2008 Bjørn-Helge Mevik Help in using PCR Jul 2, 2008

Boel Brynedal

Last active: Jul 21, 2008
1 msg
Boel Brynedal dev2bitmap error, 'gs' cannot be found Jul 21, 2008

Boks, M.P.M.

Last active: Jul 8, 2008
3 msgs
Boks, M.P.M. trivial list question Jul 1, 2008 Boks, M.P.M. Specific question on LDheatmap Jul 8, 2008 Boks, M.P.M. Automatic placement of Legends Jul 8, 2008

Booman, M

Last active: Jul 9, 2008
1 msg
Booman, M replacing value in column of data frame Jul 9, 2008

Boyce, Morgan

Last active: Jul 15, 2008
2 msgs
Boyce, Morgan matplot help Jul 9, 2008 Boyce, Morgan matplot help Jul 15, 2008

Brad McNeney

Last active: Jul 11, 2008
1 msg
Brad McNeney Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? Jul 11, 2008

Brian Lunergan

Last active: Jul 5, 2008
1 msg
Brian Lunergan using texmacs as front for R on windows xp sp2... Jul 5, 2008

Brian Ripley

Last active: Jul 31, 2008
88 msgs
Brian Ripley Using ODBC/RODBC with DBI Jul 3, 2008 Brian Ripley Installation 2.7.1 [requires Perl >= 5.8.0] Jul 3, 2008 Brian Ripley How do I paste double quotes arround a character string? Jul 3, 2008 Brian Ripley Akaike or BIC criteria for feed-forward neural nets Jul 3, 2008 Brian Ripley select.list() cannot be used non-interactively Jul 3, 2008 Brian Ripley Orthogonal polynomials and poly Jul 3, 2008 Brian Ripley Problem with loading library-ks Jul 3, 2008 Brian Ripley Can't install package Matrix on solaris. Jul 3, 2008 Brian Ripley how to automatically maximize the graph window (under XP) ? Jul 3, 2008 Brian Ripley How do I paste double quotes arround a character string? Jul 3, 2008 Brian Ripley How to emulate perl style of reading files ? Jul 3, 2008 Brian Ripley Problem in installing Biobase Jul 4, 2008 Brian Ripley update search path for attached data Jul 4, 2008 Brian Ripley Re ad in a file - produce independent vectors Jul 4, 2008 Brian Ripley set type of SS in anova() Jul 5, 2008 Brian Ripley synthax for R CMD INSTALL Jul 5, 2008 Brian Ripley Different Autocorrelation using R and other softwares Jul 6, 2008 Brian Ripley odfWeave problem in 7.1? Jul 12, 2008 Brian Ripley R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 13, 2008 Brian Ripley source code for R-dev packages Jul 14, 2008 Brian Ripley rm(l*) Jul 14, 2008 Brian Ripley dll problem Jul 14, 2008 Brian Ripley position of a specific character Jul 15, 2008 Brian Ripley Proxy again, this time on a Mac Jul 15, 2008 Brian Ripley Supressing printing from a function: ecdf Jul 15, 2008 Brian Ripley Reading SPSS .por files Jul 18, 2008 Brian Ripley Reading SPSS .por files Jul 18, 2008 Brian Ripley Reading SPSS .por files Jul 18, 2008 Brian Ripley drawing segments through points with pch=1 Jul 20, 2008 Brian Ripley Access to values of function arguments Jul 20, 2008 Brian Ripley asp and ylim Jul 20, 2008 Brian Ripley RODBC - problems using odbcDriverConnect without DSN Jul 21, 2008 Brian Ripley CART and CHAID Jul 21, 2008 Brian Ripley Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008 Brian Ripley par("din") vs dev.size() Jul 21, 2008 Brian Ripley dev2bitmap error, 'gs' cannot be found Jul 21, 2008 Brian Ripley Creation of png=problems Jul 22, 2008 Brian Ripley determing font type in expression Jul 22, 2008 Brian Ripley rpart$where and predict.rpart Jul 22, 2008 Brian Ripley Opening files from R terminal - appologies Jul 22, 2008 Brian Ripley S4 : setGeneric for classical methods Jul 22, 2008 Brian Ripley Does R have SQL interface in windows? Jul 22, 2008 Brian Ripley maximum likelihood method to fit a model Jul 23, 2008 Brian Ripley par() function does not work Jul 23, 2008 Brian Ripley R package Jul 23, 2008 Brian Ripley Using RODBC to use SQL queries Jul 23, 2008 Brian Ripley Simple... but... Jul 23, 2008 Brian Ripley Sample on dataframe Jul 23, 2008 Brian Ripley Functions similar to step() and all.effects() that work for lme() objects? Jul 24, 2008 Brian Ripley time zone - best way to shift hours Jul 24, 2008 Brian Ripley error with .dll file and RGtk2 Jul 24, 2008 Brian Ripley R-package install Jul 25, 2008 Brian Ripley Installation error for RCurl in Redhat enterrpise 5 Jul 25, 2008 Brian Ripley problem in choosing cran mirror ! Jul 25, 2008 Brian Ripley Error - unable to load shared library Jul 25, 2008 Brian Ripley Fit a 3-Dimensional Line to Data Points Jul 25, 2008 Brian Ripley R-package install Jul 26, 2008 Brian Ripley Thin frame line around R pdf output in LaTeX Jul 26, 2008 Brian Ripley parametric bootstrap Jul 26, 2008 Brian Ripley Complex to polar? Jul 27, 2008 Brian Ripley How to set directory Rscript runs in/Sweave output directory Jul 27, 2008 Brian Ripley Using stop ( ) from a Text Editor Jul 28, 2008 Brian Ripley speeding up loop and dealing wtih memory problems Jul 28, 2008 Brian Ripley Converting from char to POSIX: Jul 28, 2008 Brian Ripley RODBC to query an Oracle table Jul 28, 2008 Brian Ripley Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008 Brian Ripley in axis() suppressing axis line but keeping tick marks Jul 28, 2008 Brian Ripley Rf_error crashes entire program. Jul 28, 2008 Brian Ripley Problem reading a particular file with read.spss() Jul 29, 2008 Brian Ripley Installing BRugs Jul 29, 2008 Brian Ripley Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Jul 29, 2008 Brian Ripley Negative Binomial Regression Jul 29, 2008 Brian Ripley Removing script file Jul 29, 2008 Brian Ripley Negative Binomial Regression Jul 29, 2008 Brian Ripley try question Jul 29, 2008 Brian Ripley R command history -- can it be like Matlab's? Jul 29, 2008 Brian Ripley Need help Jul 30, 2008 Brian Ripley Need help Jul 30, 2008 Brian Ripley Rprintf will not build in my C++ compiler Jul 30, 2008 Brian Ripley setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008 Brian Ripley System exit codes Jul 30, 2008 Brian Ripley predict rpart: new data has new level Jul 30, 2008 Brian Ripley High resolution graphics from R Windows Vista Jul 30, 2008 Brian Ripley multiple separators in scan() functions Jul 30, 2008 Brian Ripley nls weights warning message Jul 31, 2008 Brian Ripley nls weights warning message Jul 31, 2008 Brian Ripley allocMatrix limits Jul 31, 2008 Brian Ripley dput vs unclass to see what a factor really is composed of Jul 31, 2008

Briantgr

Last active: Jul 10, 2008
1 msg
Briantgr Problem when building a test R package on PC Jul 10, 2008

Brooke LaFlamme

Last active: Jul 5, 2008
1 msg
Brooke LaFlamme interpreting mixed model anova results Jul 5, 2008

Brown, Andrew A

Last active: Jul 21, 2008
1 msg
Brown, Andrew A help with integrate function Jul 21, 2008

Bruno P Masi

Last active: Jul 31, 2008
2 msgs
Bruno P Masi curva PI Jul 30, 2008 Bruno P Masi P-I curve Jul 31, 2008

Bryan Hanson

Last active: Jul 20, 2008
4 msgs
Bryan Hanson .First and .Rprofile won't run on startup Jul 14, 2008 Bryan Hanson Conditionally Updating Lattice Plots Jul 20, 2008 Bryan Hanson Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008 Bryan Hanson Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008

Bunny, lautloscrew.com

Last active: Jul 12, 2008
4 msgs
Bunny, lautloscrew.com get formatted regression output Jul 2, 2008 Bunny, lautloscrew.com *** significance with xtable Jul 3, 2008 Bunny, lautloscrew.com shapiro wilk normality test Jul 12, 2008 Bunny, lautloscrew.com shapiro wilk normality test Jul 12, 2008

C.H.

Last active: Jul 12, 2008
1 msg
C.H. shapiro wilk normality test Jul 12, 2008

CJ Jackson

Last active: Jul 18, 2008
1 msg
CJ Jackson Polynomial Approximation with Exponential Kernel Jul 18, 2008

Carl Witthoft

Last active: Jul 25, 2008
9 msgs
Carl Witthoft Fitting a curve to data Jul 1, 2008 Carl Witthoft Fitting a curve to data Jul 1, 2008 Carl Witthoft what can we do when R gives no response Jul 3, 2008 Carl Witthoft Sum(Random Numbers)=100 Jul 8, 2008 Carl Witthoft recursively divide a value to get a sequence Jul 9, 2008 Carl Witthoft any way to set defaults for par? Jul 13, 2008 Carl Witthoft NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Carl Witthoft How to pass function argument of same name to internal call? Jul 25, 2008 Carl Witthoft Bug in gap.plot Jul 25, 2008

Carlisle Thacker

Last active: Jul 10, 2008
1 msg
Carlisle Thacker search with help.start Jul 10, 2008

Caroline Keef

Last active: Jul 14, 2008
3 msgs
Caroline Keef Strptime/ date time classes Jul 9, 2008 Caroline Keef Strptime/ date time classes Jul 9, 2008 Caroline Keef Strptime/ date time classes Jul 14, 2008

Carson Farmer

Last active: Jul 2, 2008
1 msg
Carson Farmer set values in data.frame to NA conditional on another data.frame Jul 2, 2008

Chaofeng Kou

Last active: Jul 18, 2008
1 msg
Chaofeng Kou generate repeats of a vector's elements Jul 18, 2008

Charilaos Skiadas

Last active: Jul 29, 2008
1 msg
Charilaos Skiadas keywords Jul 29, 2008

Charles Annis, P.E.

Last active: Jul 29, 2008
4 msgs
Charles Annis, P.E. Install Packages in Windows Vista Jul 1, 2008 Charles Annis, P.E. shapiro wilk normality test Jul 13, 2008 Charles Annis, P.E. REvolution computing Jul 18, 2008 Charles Annis, P.E. Legality Question about R's Open Source GNU GPL License Jul 29, 2008

Charles C. Berry

Last active: Jul 21, 2008
10 msgs
Charles C. Berry how do I read only specific columns using read.csv or other read function Jul 2, 2008 Charles C. Berry odd dnorm behaviour (?) Jul 7, 2008 Charles C. Berry extracting index list when using tapply() Jul 8, 2008 Charles C. Berry number of effective tests Jul 10, 2008 Charles C. Berry More compact form of lm object that can be used for prediction? Jul 11, 2008 Charles C. Berry how do I read only specific columns using read.csv or other read function Jul 13, 2008 Charles C. Berry Difficultes with grep Jul 13, 2008 Charles C. Berry Sampling distribution (PDF & CDF) of correlation Jul 17, 2008 Charles C. Berry combining lists of pairs Jul 17, 2008 Charles C. Berry avoid loop with three-dimensional array Jul 21, 2008

Charlotte Falk Mogensen

Last active: Jul 18, 2008
1 msg
Charlotte Falk Mogensen Installation of garchOxFit Jul 18, 2008

Chibisi Chima-Okereke

Last active: Jul 8, 2008
2 msgs
Chibisi Chima-Okereke Problems with lm() Jul 7, 2008 Chibisi Chima-Okereke Problems with lm() Jul 8, 2008

Chris Gaiteri

Last active: Jul 10, 2008
1 msg
Chris Gaiteri embarrassingly parallel problem - simple loop solution Jul 10, 2008

Chris82

Last active: Jul 23, 2008
2 msgs
Chris82 Flip Matrix form file? Jul 23, 2008 Chris82 Flip Matrix form file? Jul 23, 2008

Christian Hennig

Last active: Jul 29, 2008
2 msgs
Christian Hennig About clustering techniques Jul 29, 2008 Christian Hennig About clustering techniques Jul 29, 2008

Christian Hof

Last active: Jul 22, 2008
1 msg
Christian Hof data transformation Jul 22, 2008

Christian Ritz

Last active: Jul 12, 2008
1 msg
Christian Ritz Quick plotmath question Jul 12, 2008

Christian Ruckert

Last active: Jul 9, 2008
1 msg
Christian Ruckert rJava crashes jvm Jul 9, 2008

Christine A.

Last active: Jul 18, 2008
1 msg
Christine A. How to cut data elements included in a text line Jul 18, 2008

Christofer Bogaso

Last active: Jul 23, 2008
2 msgs
Christofer Bogaso Off-topic - Data needed Jul 15, 2008 Christofer Bogaso Quantitative analysis of non-standard scatter plots. Jul 23, 2008

Christoph Meyer

Last active: Jul 10, 2008
1 msg
Christoph Meyer xYplot customizing y-axis scaling Jul 10, 2008

Christoph Scherber

Last active: Jul 25, 2008
8 msgs
Christoph Scherber Problems with lm() Jul 17, 2008 Christoph Scherber lm() question Jul 17, 2008 Christoph Scherber lmer model with continuos non normal response variable, transformation needed? Jul 24, 2008 Christoph Scherber Functions similar to step() and all.effects() that work for lme() objects? Jul 24, 2008 Christoph Scherber What is wrong with this contrast matrix? Jul 24, 2008 Christoph Scherber What is wrong with this contrast matrix? Jul 24, 2008 Christoph Scherber Three contrast matrices on the same linear model Jul 25, 2008 Christoph Scherber Interactive plot using playwith() and abline Jul 25, 2008

Christophe Dutang

Last active: Jul 19, 2008
2 msgs
Christophe Dutang system time - windows specific problem Jul 18, 2008 Christophe Dutang system time - windows specific problem Jul 19, 2008

Christophe Genolini

Last active: Jul 28, 2008
18 msgs
Christophe Genolini A (not so) Short Introduction to S4 Jul 12, 2008 Christophe Genolini R logo Jul 15, 2008 Christophe Genolini R logo Jul 16, 2008 Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008 Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008 Christophe Genolini NAMESPACE vs internal.Rd Jul 16, 2008 Christophe Genolini R logo Jul 16, 2008 Christophe Genolini probleme with R CMD check Jul 18, 2008 Christophe Genolini probleme with R CMD check Jul 18, 2008 Christophe Genolini Sweave add code \201 Jul 19, 2008 Christophe Genolini Sweave add code \201 Jul 20, 2008 Christophe Genolini S4 : setGeneric for classical methods Jul 22, 2008 Christophe Genolini S4 : setGeneric for classical methods Jul 22, 2008 Christophe Genolini path and R CMD check Jul 23, 2008 Christophe Genolini path and R CMD check Jul 25, 2008 Christophe Genolini S4 : setGeneric for classical methods Jul 26, 2008 Christophe Genolini S4 : setGeneric for classical methods Jul 27, 2008 Christophe Genolini S4 : setGeneric for classical methods Jul 28, 2008

Christopher Gürke

Last active: Jul 12, 2008
1 msg
Christopher Gürke Help with arima.sim Jul 12, 2008

Christopher W. Ryan

Last active: Jul 24, 2008
4 msgs
Christopher W. Ryan question about a small "for" loop Jul 14, 2008 Christopher W. Ryan question about a small "for" loop Jul 14, 2008 Christopher W. Ryan plot(linear model) without lines Jul 16, 2008 Christopher W. Ryan OT: course in research administration Jul 24, 2008

Christos Hatzis

Last active: Jul 31, 2008
5 msgs
Christos Hatzis Fill in NA values in vector with previous character/factor Jul 28, 2008 Christos Hatzis finding a faster way to do an iterative computation Jul 29, 2008 Christos Hatzis john chambers R book Jul 30, 2008 Christos Hatzis Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008 Christos Hatzis Grouping Index of Matrix Based on Certain Condition Jul 31, 2008

Chua Siang Li

Last active: Jul 30, 2008
8 msgs
Chua Siang Li Otpmial initial centroid in kmeans Jul 2, 2008 Chua Siang Li CART and CHAID Jul 20, 2008 Chua Siang Li CART and CHAID Jul 21, 2008 Chua Siang Li rpart$where and predict.rpart Jul 22, 2008 Chua Siang Li rpart$where and predict.rpart Jul 22, 2008 Chua Siang Li rpart node number Jul 22, 2008 Chua Siang Li colnames from read.table Jul 30, 2008 Chua Siang Li predict rpart: new data has new level Jul 30, 2008

Chuck Cleland

Last active: Jul 29, 2008
5 msgs
Chuck Cleland Help on Analysis of covariance Jul 1, 2008 Chuck Cleland macros in R Jul 14, 2008 Chuck Cleland A question about using function plot Jul 14, 2008 Chuck Cleland sunrise sunset calculations Jul 15, 2008 Chuck Cleland Problem reading a particular file with read.spss() Jul 29, 2008

Claire Delle Luche

Last active: Jul 24, 2008
1 msg
Claire Delle Luche SPR experiment: using lmer, transforming data, collinearity, and using a covariable Jul 24, 2008

Clark, Jennifer H

Last active: Jul 24, 2008
1 msg
Clark, Jennifer H incrementing for loop by 2 Jul 24, 2008

Corey Sparks

Last active: Jul 16, 2008
1 msg
Corey Sparks Likelihood ratio test between glm and glmer fits Jul 16, 2008

DS

Last active: Jul 8, 2008
5 msgs
DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008 DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008 DS question on lm or glm matrix of coeficients X test data terms Jul 7, 2008 DS question on lm or glm matrix of coeficients X test data terms Jul 8, 2008 DS question on lm or glm matrix of coeficients X test data terms Jul 8, 2008

Dani Valverde

Last active: Jul 9, 2008
1 msg
Dani Valverde Expression in axis Jul 9, 2008

Daniel Folkinshteyn

Last active: Jul 23, 2008
1 msg
Daniel Folkinshteyn Quantitative analysis of non-standard scatter plots. Jul 23, 2008

Daniel Malter

Last active: Jul 19, 2008
34 msgs
Daniel Malter PCA : Error in eigen(cv, Jul 1, 2008 Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008 Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008 Daniel Malter GLM, LMER, GEE interpretation Jul 7, 2008 Daniel Malter Problems with lm() Jul 7, 2008 Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008 Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008 Daniel Malter Sum(Random Numbers)=100 Jul 8, 2008 Daniel Malter aggregate() function and na.rm = TRUE Jul 8, 2008 Daniel Malter replacing value in column of data frame Jul 9, 2008 Daniel Malter Expression in axis Jul 9, 2008 Daniel Malter Expression in axis Jul 9, 2008 Daniel Malter "non-sample" standard-deviation Jul 9, 2008 Daniel Malter recursively divide a value to get a sequence Jul 9, 2008 Daniel Malter Find the closest value in a list or matrix Jul 9, 2008 Daniel Malter plot gam "main effect functions" in one graph Jul 9, 2008 Daniel Malter Sorting / editing a table Jul 10, 2008 Daniel Malter specifying data Jul 10, 2008 Daniel Malter Interpolation of data Jul 10, 2008 Daniel Malter Non-normal data issues in PhD software engineering experiment Jul 10, 2008 Daniel Malter princomp loading help Jul 10, 2008 Daniel Malter number of effective tests Jul 10, 2008 Daniel Malter data summarization etc... Jul 11, 2008 Daniel Malter data summarization etc... Jul 11, 2008 Daniel Malter Excel Trend Function Jul 12, 2008 Daniel Malter Excel Trend Function Jul 13, 2008 Daniel Malter Loop problem Jul 14, 2008 Daniel Malter how to correlate nominal variables? Jul 14, 2008 Daniel Malter modeling binary response variables Jul 14, 2008 Daniel Malter modeling binary response variables Jul 14, 2008 Daniel Malter modeling binary response variables Jul 15, 2008 Daniel Malter Stratified random sample Jul 16, 2008 Daniel Malter Discretize continous variables.... Jul 19, 2008 Daniel Malter Discretize continous variables.... Jul 19, 2008

Daniel Stahl

Last active: Jul 5, 2008
2 msgs
Daniel Stahl extracting values from a "by" function Jul 5, 2008 Daniel Stahl Problem solved: extracting values from a "by" function Jul 5, 2008

Daniel Steinberg

Last active: Jul 9, 2008
1 msg
Daniel Steinberg netCDF to TIFF Jul 9, 2008

Daniel Wagner

Last active: Jul 24, 2008
4 msgs
Daniel Wagner Help regarding arules package Jul 16, 2008 Daniel Wagner Order of columns(variables) in dataframe Jul 20, 2008 Daniel Wagner How to get rule number in arules Jul 24, 2008 Daniel Wagner How to delete duplicate cases? Jul 24, 2008

Daniela Carollo

Last active: Jul 16, 2008
1 msg
Daniela Carollo help with bivariate density plot question Jul 16, 2008

Daniela Garavaglia

Last active: Jul 25, 2008
1 msg
Daniela Garavaglia Maximization under constraits Jul 25, 2008

Daniela Ottaviani

Last active: Jul 8, 2008
1 msg
Daniela Ottaviani Question: Beginner stuck in a R cycle Jul 8, 2008

Daren Tan

Last active: Jul 31, 2008
19 msgs
Daren Tan how to capture matching words in a string ? Jul 2, 2008 Daren Tan Processing 10^8 rows and 1^3 columns Jul 2, 2008 Daren Tan How to emulate perl style of reading files ? Jul 3, 2008 Daren Tan passing arguments to a R script Jul 4, 2008 Daren Tan How can I optimize this piece of code ? Jul 7, 2008 Daren Tan Can R do this ? Jul 7, 2008 Daren Tan Installing R package but got Fortran 90 error Jul 8, 2008 Daren Tan How to check how much memory has been used or reserved ? Jul 10, 2008 Daren Tan How to output 0.405852702657738 as 0.405853 ? Jul 10, 2008 Daren Tan Computing row means for sets of 2 columns Jul 13, 2008 Daren Tan Computing row means for sets of 2 columns Jul 13, 2008 Daren Tan counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008 Daren Tan Combining 4th column from 30 files Jul 23, 2008 Daren Tan convert a vector of words into a matrix Jul 23, 2008 Daren Tan convert a vector of words into a matrix Jul 24, 2008 Daren Tan How to preserve the numeric format and digits ? Jul 24, 2008 Daren Tan Relying on R to generate html tables with hyperlinks and pictures ? Jul 24, 2008 Daren Tan Can't get the correct order from melt.data.frame of reshape library. Jul 26, 2008 Daren Tan Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008

Darin Brooks

Last active: Jul 21, 2008
3 msgs
Darin Brooks R Commander question Jul 14, 2008 Darin Brooks R Commander question Jul 14, 2008 Darin Brooks CART Analysis Jul 21, 2008

Darren Weber

Last active: Jul 22, 2008
1 msg
Darren Weber deblur microscope image stacks Jul 22, 2008

DaveFrisch

Last active: Jul 10, 2008
3 msgs
DaveFrisch What's the T-Value in fisher.test Jul 10, 2008 DaveFrisch Interpretation of EXACT Statistical Test in finding the probability as Std. Deviations (SumP) Jul 10, 2008 DaveFrisch Interpretation of EXACT Statistical Test in finding the Jul 10, 2008

David Afshartous

Last active: Jul 30, 2008
9 msgs
David Afshartous auto.key in xyplot in conjunction with panel.text Jul 2, 2008 David Afshartous auto.key in xyplot in conjunction with panel.text Jul 3, 2008 David Afshartous Installation of packages via GUI, Mac OS X Jul 3, 2008 David Afshartous aggregate() function and na.rm = TRUE Jul 8, 2008 David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008 David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008 David Afshartous Auto.key colors maintained when subsetting Jul 9, 2008 David Afshartous Pairs() function: selective changing of ylim; use of key Jul 25, 2008 David Afshartous Axes in perspective plot - persp() Jul 30, 2008

David Barron

Last active: Jul 31, 2008
1 msg
David Barron Random number generation Jul 31, 2008

David Carslaw

Last active: Jul 24, 2008
1 msg
David Carslaw time zone - best way to shift hours Jul 24, 2008

David Epstein

Last active: Jul 21, 2008
9 msgs
David Epstein Error in edit(name,file,title,editor) Jul 20, 2008 David Epstein Error in edit(name,file,title,editor) Jul 20, 2008 David Epstein drawing segments through points with pch=1 Jul 20, 2008 David Epstein drawing segments through points with pch=1 Jul 20, 2008 David Epstein asp and ylim Jul 20, 2008 David Epstein asp and ylim Jul 20, 2008 David Epstein asp and ylim Jul 21, 2008 David Epstein asp and ylim Jul 21, 2008 David Epstein asp and ylim Jul 21, 2008

David Freedman

Last active: Jul 24, 2008
2 msgs
David Freedman fill in area between 2 lines with a color Jul 20, 2008 David Freedman ggplot2 help Jul 24, 2008

David Hajage

Last active: Jul 28, 2008
4 msgs
David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008 David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008 David Hajage Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 26, 2008 David Hajage speeding up loop and dealing wtih memory problems Jul 28, 2008

David Henderson

Last active: Jul 29, 2008
3 msgs
David Henderson REvolution computing Jul 17, 2008 David Henderson Legality Question about R's Open Source GNU GPL License Jul 29, 2008 David Henderson Legality Question about R's Open Source GNU GPL License Jul 29, 2008

David Katz

Last active: Jul 28, 2008
2 msgs
David Katz Random Forest %var(y) Jul 5, 2008 David Katz Case statements in R Jul 28, 2008

David Reinke

Last active: Jul 8, 2008
2 msgs
David Reinke Method for checking automatically which distribtions fits a data Jul 7, 2008 David Reinke calculation of entropy in R??? Jul 8, 2008

David Scott

Last active: Jul 28, 2008
2 msgs
David Scott Interactive plot Jul 24, 2008 David Scott RODBC to query an Oracle table Jul 28, 2008

Davide Massidda

Last active: Jul 17, 2008
2 msgs
Davide Massidda Problem with TLC/TK on Ubuntu Jul 17, 2008 Davide Massidda Problem with TLC/TK on Ubuntu Jul 17, 2008

De Tuimelaar

Last active: Jul 15, 2008
1 msg
De Tuimelaar generalized spatial autoregressive lag model Jul 15, 2008

Deepayan Sarkar

Last active: Jul 31, 2008
16 msgs
Deepayan Sarkar Graph Order in xyplot Jul 1, 2008 Deepayan Sarkar dev.off() inside a function & other glitches Jul 1, 2008 Deepayan Sarkar conversion of data for use within barchart Jul 2, 2008 Deepayan Sarkar auto.key in xyplot in conjunction with panel.text Jul 2, 2008 Deepayan Sarkar Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions Jul 3, 2008 Deepayan Sarkar Auto.key colors maintained when subsetting Jul 9, 2008 Deepayan Sarkar Auto.key colors maintained when subsetting Jul 9, 2008 Deepayan Sarkar Lattice: merged strips? Jul 11, 2008 Deepayan Sarkar barchart with bars attached to y=0-line Jul 16, 2008 Deepayan Sarkar Conditionally Updating Lattice Plots Jul 21, 2008 Deepayan Sarkar Lattice: How to draw curves from given formulae Jul 22, 2008 Deepayan Sarkar Lattice: How to draw curves from given formulae Jul 22, 2008 Deepayan Sarkar Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 30, 2008 Deepayan Sarkar Unexpected line type in lattice plot key on pdf device Jul 30, 2008 Deepayan Sarkar strip names lattice graphics Jul 31, 2008 Deepayan Sarkar bwplot with Date object Jul 31, 2008

Denise Xifara

Last active: Jul 28, 2008
4 msgs
Denise Xifara fama-macbeth Jul 21, 2008 Denise Xifara fama-macbeth Jul 21, 2008 Denise Xifara loop for multiple regressions Jul 22, 2008 Denise Xifara speeding up loop and dealing wtih memory problems Jul 28, 2008

Dennis Fisher

Last active: Jul 29, 2008
2 msgs
Dennis Fisher Odd behavior of remove command Jul 15, 2008 Dennis Fisher Removing script file Jul 29, 2008

Detlef Steuer

Last active: Jul 22, 2008
3 msgs
Detlef Steuer Problem installing R on openSUSE 10.3 Jul 15, 2008 Detlef Steuer Problem installing R on openSUSE 10.3 Jul 15, 2008 Detlef Steuer Cannot re-start R after bus error Jul 22, 2008

Dieter Menne

Last active: Jul 28, 2008
4 msgs
Dieter Menne odfWeave problem in 7.1? Jul 10, 2008 Dieter Menne R interprets symbol as q() Jul 20, 2008 Dieter Menne melting a list: basic question Jul 25, 2008 Dieter Menne how to add notes to the graph? Jul 28, 2008

Dimitris Rizopoulos

Last active: Jul 28, 2008
13 msgs
Dimitris Rizopoulos Loop problem Jul 14, 2008 Dimitris Rizopoulos Group level frequencies Jul 16, 2008 Dimitris Rizopoulos Likelihood ratio test between glm and glmer fits Jul 16, 2008 Dimitris Rizopoulos column wise paste of data.frames Jul 18, 2008 Dimitris Rizopoulos generate repeats of a vector's elements Jul 18, 2008 Dimitris Rizopoulos Order of columns(variables) in dataframe Jul 20, 2008 Dimitris Rizopoulos fill in area between 2 lines with a color Jul 20, 2008 Dimitris Rizopoulos vector help Jul 21, 2008 Dimitris Rizopoulos Table orderd by frequencies Jul 22, 2008 Dimitris Rizopoulos Simple... but... Jul 23, 2008 Dimitris Rizopoulos incrementing for loop by 2 Jul 24, 2008 Dimitris Rizopoulos Help with rep Jul 25, 2008 Dimitris Rizopoulos Fill in NA values in vector with previous character/factor Jul 28, 2008

Dirk Eddelbuettel

Last active: Jul 17, 2008
7 msgs
Dirk Eddelbuettel WIERD: Basic computing in R Jul 1, 2008 Dirk Eddelbuettel passing a variable at the command line Jul 1, 2008 Dirk Eddelbuettel problem with mpiexec and Rmpi Jul 1, 2008 Dirk Eddelbuettel problem with mpiexec and Rmpi Jul 1, 2008 Dirk Eddelbuettel How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008 Dirk Eddelbuettel enscript states file for R scripts? Jul 15, 2008 Dirk Eddelbuettel Problem with TLC/TK on Ubuntu Jul 17, 2008

Dirk Nemitz

Last active: Jul 22, 2008
1 msg
Dirk Nemitz randomForest Tutorial Jul 22, 2008

Don MacQueen

Last active: Jul 26, 2008
5 msgs
Don MacQueen Installation of packages via GUI, Mac OS X Jul 3, 2008 Don MacQueen Interpolation of data Jul 10, 2008 Don MacQueen Editor fpr Mac OS Jul 21, 2008 Don MacQueen Installing R packages in Textmate Jul 24, 2008 Don MacQueen Data length mismatch. Jul 26, 2008

Donald Braman

Last active: Jul 15, 2008
1 msg
Donald Braman sem & testing multiple hypotheses with BIC Jul 15, 2008

Dong-hyun Oh

Last active: Jul 21, 2008
4 msgs
Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008 Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008 Dong-hyun Oh Find classes of each column of data.frame() Jul 1, 2008 Dong-hyun Oh On creating grouped data set. Jul 21, 2008

Donna Tucker

Last active: Jul 2, 2008
1 msg
Donna Tucker neural networks Jul 2, 2008

Doran, Harold

Last active: Jul 23, 2008
11 msgs
Doran, Harold matrix multiplication question Jul 18, 2008 Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Doran, Harold Large number of dummy variables Jul 21, 2008 Doran, Harold Large number of dummy variables Jul 21, 2008 Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Doran, Harold Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Doran, Harold Simple... but... Jul 23, 2008 Doran, Harold Simple... but... Jul 23, 2008 Doran, Harold Simple... but... Jul 23, 2008

Douglas Bates

Last active: Jul 28, 2008
8 msgs
Douglas Bates Question regarding lu in package Matrix Jul 9, 2008 Douglas Bates a warning message from lmer Jul 12, 2008 Douglas Bates a warning message from lmer Jul 12, 2008 Douglas Bates Regression problem Jul 15, 2008 Douglas Bates Likelihood ratio test between glm and glmer fits Jul 17, 2008 Douglas Bates Large number of dummy variables Jul 21, 2008 Douglas Bates glht after lmer with "$S4class-" and "missing model.matrix-" errors Jul 25, 2008 Douglas Bates Mixed model question. Jul 28, 2008

Dry, Jonathan R

Last active: Jul 11, 2008
2 msgs
Dry, Jonathan R network Jul 11, 2008 Dry, Jonathan R network Jul 11, 2008

Dumblauskas, Jerry

Last active: Jul 3, 2008
1 msg
Dumblauskas, Jerry Usage of rJava (.jcall) with Weka functions, any example? Jul 3, 2008

Duncan Mackay

Last active: Jul 9, 2008
2 msgs
Duncan Mackay Lattice: merged strips? Jul 9, 2008 Duncan Mackay Finding Values that Occur Most Often in a Vector Jul 9, 2008

Duncan Murdoch

Last active: Jul 31, 2008
70 msgs
Duncan Murdoch dev.off() inside a function & other glitches Jul 1, 2008 Duncan Murdoch adding a package in Windows Jul 1, 2008 Duncan Murdoch Plotting Prediction Surface with persp() Jul 2, 2008 Duncan Murdoch How to emulate perl style of reading files ? Jul 3, 2008 Duncan Murdoch Re membering the last time an event occurred within a dataframe Jul 3, 2008 Duncan Murdoch stop without error message Jul 4, 2008 Duncan Murdoch looking for alternative of 'if-else' Jul 6, 2008 Duncan Murdoch Interpreting messages when building packages Jul 6, 2008 Duncan Murdoch Windows Only: winMenuAdd() problem Jul 6, 2008 Duncan Murdoch looking for alternative of 'if-else' Jul 6, 2008 Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008 Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008 Duncan Murdoch Regular expressions: bug or misunderstanding? Jul 6, 2008 Duncan Murdoch Change language in Rcmdr Jul 7, 2008 Duncan Murdoch Interpreting messages when building packages Jul 7, 2008 Duncan Murdoch subset() multiple arguments Jul 7, 2008 Duncan Murdoch Interpreting messages when building packages Jul 7, 2008 Duncan Murdoch R package Jul 8, 2008 Duncan Murdoch nls and "plinear" algorithm Jul 8, 2008 Duncan Murdoch Change in behaviour of sd() Jul 8, 2008 Duncan Murdoch Sweave figure Jul 9, 2008 Duncan Murdoch Comparing complex numbers Jul 11, 2008 Duncan Murdoch Error of exp() in a dll from Fortran Jul 12, 2008 Duncan Murdoch Assoociative array? Jul 12, 2008 Duncan Murdoch Assoociative array? Jul 12, 2008 Duncan Murdoch How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008 Duncan Murdoch Assoociative array? Jul 12, 2008 Duncan Murdoch stem and leaf plot: how to edit the stem-values Jul 13, 2008 Duncan Murdoch How to load stats4 package Jul 14, 2008 Duncan Murdoch Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008 Duncan Murdoch statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008 Duncan Murdoch R-source code of a function Jul 16, 2008 Duncan Murdoch Function to verify existence of an R object Jul 16, 2008 Duncan Murdoch calculate differences - strange outcome Jul 17, 2008 Duncan Murdoch Colours in R Jul 17, 2008 Duncan Murdoch ubuntu and rgl package vs suse ?? static plots Jul 17, 2008 Duncan Murdoch matrix multiplication question Jul 17, 2008 Duncan Murdoch system time - windows specific problem Jul 19, 2008 Duncan Murdoch smooth.spline Jul 20, 2008 Duncan Murdoch Getting plot axes where they should be! Jul 21, 2008 Duncan Murdoch Using integrate Jul 21, 2008 Duncan Murdoch par() function does not work Jul 23, 2008 Duncan Murdoch shQuote and cat Jul 23, 2008 Duncan Murdoch truncated normal Jul 23, 2008 Duncan Murdoch truncated normal Jul 23, 2008 Duncan Murdoch truncated normal Jul 23, 2008 Duncan Murdoch Is there an equivalent * operator? Jul 24, 2008 Duncan Murdoch Interactive plot Jul 24, 2008 Duncan Murdoch Just 2 more questions - for now! Jul 24, 2008 Duncan Murdoch Problem with scatterplot3d example Jul 24, 2008 Duncan Murdoch Interactive plot Jul 24, 2008 Duncan Murdoch how know the status of particular process Jul 24, 2008 Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008 Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008 Duncan Murdoch Tutorial on rgl Graphics Jul 25, 2008 Duncan Murdoch Minor Bug in Documentation of merge() Jul 25, 2008 Duncan Murdoch How to pass function argument of same name to internal call? Jul 25, 2008 Duncan Murdoch Numerical question Jul 25, 2008 Duncan Murdoch how i can install Rgraphviz in R2.7.1 Jul 26, 2008 Duncan Murdoch S-PLUS code in R Jul 26, 2008 Duncan Murdoch Legality Question about R's Open Source GNU GPL License Jul 28, 2008 Duncan Murdoch Rf_error crashes entire program. Jul 28, 2008 Duncan Murdoch Is there a way to avoid loading dependendent packages? Jul 28, 2008 Duncan Murdoch 'for' loop, two variables Jul 29, 2008 Duncan Murdoch Colors in Sweave Jul 29, 2008 Duncan Murdoch Eclipse/Statet: How to set breakpoints Jul 30, 2008 Duncan Murdoch Eclipse/Statet: How to set breakpoints Jul 30, 2008 Duncan Murdoch History pruning Jul 31, 2008 Duncan Murdoch instal tar.gz package on windows Jul 31, 2008 Duncan Murdoch dput vs unclass to see what a factor really is composed of Jul 31, 2008

Duncan Temple Lang

Last active: Jul 28, 2008
1 msg
Duncan Temple Lang RStem with portuguese language Jul 28, 2008

Dylan Beaudette

Last active: Jul 30, 2008
8 msgs
Dylan Beaudette rbinom for a matrix Jul 9, 2008 Dylan Beaudette rbinom for a matrix Jul 9, 2008 Dylan Beaudette Grid building in R Jul 9, 2008 Dylan Beaudette meaning of tests presented in anova(ols(...)) {Design package} Jul 14, 2008 Dylan Beaudette gstat problem with lidar data Jul 16, 2008 Dylan Beaudette R: gstat problem with lidar data Jul 16, 2008 Dylan Beaudette alternate usage of soil.texture (plotrix) Jul 21, 2008 Dylan Beaudette Re creating Procrustes Plot in Lattice Jul 30, 2008

Earl F. Glynn

Last active: Jul 17, 2008
4 msgs
Earl F. Glynn Drawing a colour wheel - bug in hcl? Jul 7, 2008 Earl F. Glynn Drawing a colour wheel - bug in hcl? Jul 7, 2008 Earl F. Glynn Function to verify existence of an R object Jul 16, 2008 Earl F. Glynn Colours in R Jul 17, 2008

Eben Goodale

Last active: Jul 23, 2008
1 msg
Eben Goodale pvclust Jul 23, 2008

Economics Guy

Last active: Jul 31, 2008
1 msg
Economics Guy Randomly drawing observations from factors. Jul 31, 2008

Edna Bell

Last active: Jul 29, 2008
13 msgs
Edna Bell an extremely simple question Jul 22, 2008 Edna Bell factor question Jul 24, 2008 Edna Bell ggplot2 help Jul 24, 2008 Edna Bell Cairo graphics Jul 24, 2008 Edna Bell still more dumb questions Jul 24, 2008 Edna Bell read.table question Jul 27, 2008 Edna Bell environment question Jul 28, 2008 Edna Bell keywords Jul 29, 2008 Edna Bell more environment questions Jul 29, 2008 Edna Bell table questions Jul 29, 2008 Edna Bell more environment questions Jul 29, 2008 Edna Bell ls() and memory question Jul 29, 2008 Edna Bell try question Jul 29, 2008

Edwin Lei

Last active: Jul 5, 2008
4 msgs
Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008 Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008 Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008 Edwin Lei trying to superimpose a line plot onto a histogram Jul 5, 2008

Ehsan Karim

Last active: Jul 17, 2008
1 msg
Ehsan Karim Histogram with two colors depending on condition Jul 17, 2008

Eli Meyer

Last active: Jul 14, 2008
1 msg
Eli Meyer Analysis of poorly replicated array data Jul 14, 2008

Elke Moons

Last active: Jul 23, 2008
1 msg
Elke Moons Simulating multilevel responses Jul 23, 2008

Emili Tortosa-Ausina

Last active: Jul 10, 2008
1 msg
Emili Tortosa-Ausina quantile regression estimation results Jul 10, 2008

Emmanuel Charpentier

Last active: Jul 17, 2008
1 msg
Emmanuel Charpentier shapiro wilk normality test Jul 17, 2008

Endre Domiczi

Last active: Jul 28, 2008
1 msg
Endre Domiczi How to unsubscribe? Jul 28, 2008

Eric C Banfield

Last active: Jul 23, 2008
2 msgs
Eric C Banfield Q re iterating a process and appending results to output file Jul 23, 2008 Eric C Banfield Q re iterating a process and appending results to output file Jul 23, 2008

Eric Ferreira

Last active: Jul 4, 2008
1 msg
Eric Ferreira stop without error message Jul 4, 2008

Eric Turkheimer

Last active: Jul 7, 2008
1 msg
Eric Turkheimer Basic Vector and Matrix Operations Jul 7, 2008

Eric Vander Wal

Last active: Jul 7, 2008
1 msg
Eric Vander Wal Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008

Erik Iverson

Last active: Jul 31, 2008
37 msgs
Erik Iverson Help in using PCR Jul 1, 2008 Erik Iverson Set default value Jul 1, 2008 Erik Iverson "Invalid object" error in boxplot Jul 1, 2008 Erik Iverson Ignore blank columns when reading a row from a table Jul 1, 2008 Erik Iverson Hmisc latex function with longtable option Jul 2, 2008 Erik Iverson How do I paste double quotes arround a character string? Jul 2, 2008 Erik Iverson problem with lm and predict - no predictions made Jul 2, 2008 Erik Iverson Basic Vector and Matrix Operations Jul 7, 2008 Erik Iverson rbinom for a matrix Jul 9, 2008 Erik Iverson recursively divide a value to get a sequence Jul 9, 2008 Erik Iverson use variable value as vector name Jul 9, 2008 Erik Iverson Grid building in R Jul 9, 2008 Erik Iverson Sorting a matrix Jul 10, 2008 Erik Iverson Problems with Package Installation. Jul 10, 2008 Erik Iverson Meaning of Positive LogLikelihood Jul 11, 2008 Erik Iverson Help with error in "if then" statement Jul 11, 2008 Erik Iverson position of a specific character Jul 14, 2008 Erik Iverson Iterations Jul 15, 2008 Erik Iverson Regression problem Jul 15, 2008 Erik Iverson Iterations Jul 15, 2008 Erik Iverson help with data layout Jul 17, 2008 Erik Iverson Display variables when running a script Jul 17, 2008 Erik Iverson Problem with TLC/TK on Ubuntu Jul 17, 2008 Erik Iverson Function Error Jul 22, 2008 Erik Iverson Warning message in if else statement Jul 23, 2008 Erik Iverson Can R fill in missing values? Jul 23, 2008 Erik Iverson How to delete duplicate cases? Jul 24, 2008 Erik Iverson Help with which() Jul 24, 2008 Erik Iverson Help with which() Jul 24, 2008 Erik Iverson Question: how to build a subset to do separate calculations Jul 24, 2008 Erik Iverson Question: how to build a subset to do separate calculations Jul 24, 2008 Erik Iverson accessing list elements Jul 29, 2008 Erik Iverson Variable name in a String Jul 30, 2008 Erik Iverson colnames from read.table Jul 30, 2008 Erik Iverson How to output R image to a file? Jul 31, 2008 Erik Iverson Storing Matrices into Hash Jul 31, 2008 Erik Iverson Storing Matrices into Hash Jul 31, 2008

Erin Hodgess

Last active: Jul 14, 2008
5 msgs
Erin Hodgess problem with mpiexec and Rmpi Jul 1, 2008 Erin Hodgess passing a variable at the command line Jul 1, 2008 Erin Hodgess mpirun question with Rmpi Jul 11, 2008 Erin Hodgess Help with arima.sim Jul 12, 2008 Erin Hodgess macros in R Jul 14, 2008

FScottDahlgren

Last active: Jul 31, 2008
2 msgs
FScottDahlgren Create an R package Jul 24, 2008 FScottDahlgren Create an R package Jul 31, 2008

Fabio Fanoni

Last active: Jul 1, 2008
1 msg
Fabio Fanoni select.list() cannot be used non-interactively Jul 1, 2008

Fabio Sanchez

Last active: Jul 23, 2008
2 msgs
Fabio Sanchez par() function does not work Jul 23, 2008 Fabio Sanchez par() function does not work Jul 23, 2008

Famoye, Felix

Last active: Jul 27, 2008
1 msg
Famoye, Felix Fitting a Bivariate Poisson log-normal distribution Jul 27, 2008

Farley, Robert

Last active: Jul 7, 2008
1 msg
Farley, Robert Survey questions Jul 7, 2008

Federico Calboli

Last active: Jul 25, 2008
1 msg
Federico Calboli Plink bed files Jul 25, 2008

Felipe Carrillo

Last active: Jul 12, 2008
2 msgs
Felipe Carrillo SciViews GUI Jul 5, 2008 Felipe Carrillo Excel Trend Function Jul 12, 2008

Felix Andrews

Last active: Jul 29, 2008
9 msgs
Felix Andrews playwith package does not work on Ubuntu? Jul 2, 2008 Felix Andrews lattice question Jul 6, 2008 Felix Andrews playwith package crashes on Mac Jul 15, 2008 Felix Andrews barchart with bars attached to y=0-line Jul 17, 2008 Felix Andrews xyplot help Jul 22, 2008 Felix Andrews Is there an equivalent * operator? Jul 24, 2008 Felix Andrews Interactive plot using playwith() and abline Jul 25, 2008 Felix Andrews Transfer Function Modeling Jul 28, 2008 Felix Andrews How to set the parameters in Trellis Graphics (by Lattice package) Jul 29, 2008

Fensis

Last active: Jul 31, 2008
1 msg
Fensis random effects mixed model, different regressors Jul 31, 2008

Fernando Marmolejo Ramos

Last active: Jul 22, 2008
1 msg
Fernando Marmolejo Ramos adding the mean and standard deviation to boxplots Jul 22, 2008

Ferry

Last active: Jul 31, 2008
3 msgs
Ferry R-pmg (poor man gui) question Jul 25, 2008 Ferry dotFirst option Jul 30, 2008 Ferry Remove Even Number from A Vector Jul 31, 2008

Fido

Last active: Jul 20, 2008
1 msg
Fido How do I install Joomla! 1.5? Jul 20, 2008

Finch, W. Holmes

Last active: Jul 14, 2008
1 msg
Finch, W. Holmes applying complex functions by groups Jul 14, 2008

Fiona Johnson

Last active: Jul 8, 2008
1 msg
Fiona Johnson Change in behaviour of sd() Jul 8, 2008

Firas Swidan

Last active: Jul 23, 2008
2 msgs
Firas Swidan Quantitative analysis of non-standard scatter plots. Jul 23, 2008 Firas Swidan Quantitative analysis of non-standard scatter plots. Jul 23, 2008

Fotis Papailias

Last active: Jul 26, 2008
9 msgs
Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008 Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008 Fotis Papailias Time Series - Long Memory Estimation Jul 21, 2008 Fotis Papailias transcript a matlab code in R Jul 25, 2008 Fotis Papailias s-plus in R... simpler code Jul 25, 2008 Fotis Papailias S-PLUS code in R Jul 26, 2008 Fotis Papailias S-PLUS code in R Jul 26, 2008 Fotis Papailias S-PLUS code in R Jul 26, 2008 Fotis Papailias S-PLUS code in R Jul 26, 2008

Fran100681

Last active: Jul 14, 2008
3 msgs
Fran100681 Difficultes with grep Jul 11, 2008 Fran100681 Difficultes with grep Jul 13, 2008 Fran100681 Difficultes with grep Jul 14, 2008

Francisco Javier Santos Alamillos

Last active: Jul 8, 2008
3 msgs
Francisco Javier Santos Alamillos reshape matrices Jul 1, 2008 Francisco Javier Santos Alamillos reshape matrices Jul 1, 2008 Francisco Javier Santos Alamillos Help with eigenvectors Jul 8, 2008

Frank E Harrell Jr

Last active: Jul 30, 2008
28 msgs
Frank E Harrell Jr Hmisc latex function with longtable option Jul 2, 2008 Frank E Harrell Jr Biostatistician Positions at Vanderbilt University Jul 3, 2008 Frank E Harrell Jr logistic regreesion and score test Jul 4, 2008 Frank E Harrell Jr Method for checking automatically which distribtions fits a data Jul 7, 2008 Frank E Harrell Jr Automatic placement of Legends Jul 9, 2008 Frank E Harrell Jr shapiro wilk normality test Jul 13, 2008 Frank E Harrell Jr shapiro wilk normality test Jul 13, 2008 Frank E Harrell Jr meaning of tests presented in anova(ols(...)) {Design package} Jul 15, 2008 Frank E Harrell Jr Labelling curves on graphs Jul 16, 2008 Frank E Harrell Jr Labelling curves on graphs Jul 17, 2008 Frank E Harrell Jr Comparing differences in AUC from 2 different models Jul 17, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 19, 2008 Frank E Harrell Jr Discretize continous variables.... Jul 20, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008 Frank E Harrell Jr [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 24, 2008 Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008 Frank E Harrell Jr Package Hmisc, functions summary.formula() and latex(), options pdig, pctdig, eps and prmsd Jul 25, 2008 Frank E Harrell Jr extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008 Frank E Harrell Jr Coefficients of Logistic Regression from bootstrap - how to get them? Jul 30, 2008

François Aucoin

Last active: Jul 18, 2008
1 msg
François Aucoin How to solve systems of nonlinear equations in R? Jul 18, 2008

Fredrik Lundgren

Last active: Jul 26, 2008
1 msg
Fredrik Lundgren .Rprofile in RFrameworks? Jul 26, 2008

Fán Lóng

Last active: Jul 30, 2008
1 msg
Fán Lóng png() does not generate a 24 bit PNG file Jul 30, 2008

G.H. Zuo

Last active: Jul 29, 2008
1 msg
G.H. Zuo How to set the parameters in Trellis Graphics (by Lattice package) Jul 29, 2008

GOUACHE David

Last active: Jul 31, 2008
3 msgs
GOUACHE David bwplot with Date object Jul 31, 2008 GOUACHE David vertical bpplot Jul 31, 2008 GOUACHE David strip names lattice graphics Jul 31, 2008

Gabor Grothendieck

Last active: Jul 31, 2008
117 msgs
Gabor Grothendieck Add comments on plot window Jul 1, 2008 Gabor Grothendieck plot window Jul 1, 2008 Gabor Grothendieck Graph Order in xyplot Jul 1, 2008 Gabor Grothendieck Fitting a curve to data Jul 1, 2008 Gabor Grothendieck plot.zoo labels Jul 1, 2008 Gabor Grothendieck Install Packages in Windows Vista Jul 1, 2008 Gabor Grothendieck position legend below x-axis title Jul 2, 2008 Gabor Grothendieck Zoo plotting behavior Jul 2, 2008 Gabor Grothendieck Zoo plotting behavior Jul 2, 2008 Gabor Grothendieck Zoo plotting behavior Jul 2, 2008 Gabor Grothendieck Zoo plotting behavior Jul 2, 2008 Gabor Grothendieck Zoo plotting behavior Jul 2, 2008 Gabor Grothendieck Multiple time series plots Jul 2, 2008 Gabor Grothendieck help appreciated to make a plot Jul 2, 2008 Gabor Grothendieck plot.zoo labels Jul 2, 2008 Gabor Grothendieck how to capture matching words in a string ? Jul 2, 2008 Gabor Grothendieck Processing 10^8 rows and 1^3 columns Jul 2, 2008 Gabor Grothendieck combining time series [was: (no subject)] Jul 3, 2008 Gabor Grothendieck combining time series [was: (no subject)] Jul 3, 2008 Gabor Grothendieck graph woes Jul 3, 2008 Gabor Grothendieck Re membering the last time an event occurred within a dataframe Jul 3, 2008 Gabor Grothendieck First attempt to use R Jul 3, 2008 Gabor Grothendieck 'as.Date' conversion of classes POSIX*t (problem/feature)? Jul 3, 2008 Gabor Grothendieck apply with a division Jul 3, 2008 Gabor Grothendieck Re ad in a file - produce independent vectors Jul 4, 2008 Gabor Grothendieck Error in defining function Jul 6, 2008 Gabor Grothendieck ts.plot Jul 6, 2008 Gabor Grothendieck Regular expressions: bug or misunderstanding? Jul 6, 2008 Gabor Grothendieck Regular expressions: bug or misunderstanding? Jul 6, 2008 Gabor Grothendieck Error in defining function Jul 6, 2008 Gabor Grothendieck Error in defining function Jul 7, 2008 Gabor Grothendieck A shorter version of ".Last.value"? Jul 7, 2008 Gabor Grothendieck one-site competition data // curve fitting Jul 8, 2008 Gabor Grothendieck Manipulate Data (with regular expressions) Jul 8, 2008 Gabor Grothendieck time series by calendar week Jul 8, 2008 Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008 Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008 Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008 Gabor Grothendieck making zoo objects with zoo without format argument? Jul 8, 2008 Gabor Grothendieck recursively divide a value to get a sequence Jul 9, 2008 Gabor Grothendieck making zoo objects with zoo without format argument? Jul 9, 2008 Gabor Grothendieck Summary Stats (not summary(x)) Jul 9, 2008 Gabor Grothendieck rollmean() Jul 9, 2008 Gabor Grothendieck Summary Stats (not summary(x)) Jul 9, 2008 Gabor Grothendieck Strptime/ date time classes Jul 9, 2008 Gabor Grothendieck Basic help needed Jul 9, 2008 Gabor Grothendieck shifting data in matrix by n rows Jul 9, 2008 Gabor Grothendieck matplot help Jul 10, 2008 Gabor Grothendieck shifting data in matrix by n rows Jul 10, 2008 Gabor Grothendieck shifting data in matrix by n rows Jul 10, 2008 Gabor Grothendieck shifting data in matrix by n rows Jul 11, 2008 Gabor Grothendieck Start preferred RGui Jul 11, 2008 Gabor Grothendieck Manipulate Data (with regular expressions) Jul 11, 2008 Gabor Grothendieck Ellipsis arguments for plot.formula Jul 11, 2008 Gabor Grothendieck Ellipsis arguments for plot.formula Jul 11, 2008 Gabor Grothendieck data summerization etc... Jul 12, 2008 Gabor Grothendieck Quick plotmath question Jul 12, 2008 Gabor Grothendieck Quick plotmath question Jul 12, 2008 Gabor Grothendieck Loop problem Jul 14, 2008 Gabor Grothendieck Data Manipulations and SQL Jul 14, 2008 Gabor Grothendieck barchart with bars attached to y=0-line Jul 16, 2008 Gabor Grothendieck date to decimal date conversion Jul 16, 2008 Gabor Grothendieck RSQLite maximum table size Jul 16, 2008 Gabor Grothendieck finding "chuncks" of data that have no NA s Jul 18, 2008 Gabor Grothendieck finding "chuncks" of data that have no NA s Jul 18, 2008 Gabor Grothendieck How to cut data elements included in a text line Jul 18, 2008 Gabor Grothendieck Change font-face in title Jul 19, 2008 Gabor Grothendieck Change font-face in title Jul 19, 2008 Gabor Grothendieck extracting colnames to label plots in a function Jul 19, 2008 Gabor Grothendieck extracting colnames to label plots in a function Jul 19, 2008 Gabor Grothendieck Non-linearly constrained optimisation Jul 19, 2008 Gabor Grothendieck estimating volume from xyz points Jul 20, 2008 Gabor Grothendieck Conditionally Updating Lattice Plots Jul 20, 2008 Gabor Grothendieck Erro updating HTML package descriptions in packages.html Jul 20, 2008 Gabor Grothendieck Erro updating HTML package descriptions in packages.html Jul 20, 2008 Gabor Grothendieck enumerate subsets Jul 20, 2008 Gabor Grothendieck asp and ylim Jul 20, 2008 Gabor Grothendieck Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008 Gabor Grothendieck Subsetting data by date Jul 21, 2008 Gabor Grothendieck Subsetting data by date Jul 21, 2008 Gabor Grothendieck Subsetting data by date Jul 21, 2008 Gabor Grothendieck Opening files from R terminal - appologies Jul 22, 2008 Gabor Grothendieck Error in installing packages Jul 22, 2008 Gabor Grothendieck Does R have SQL interface in windows? Jul 22, 2008 Gabor Grothendieck Change font-face in title Jul 22, 2008 Gabor Grothendieck .asp (not really an R question) but related Jul 22, 2008 Gabor Grothendieck Simple... but... Jul 23, 2008 Gabor Grothendieck Using PrettyR to produce LaTeX output Jul 23, 2008 Gabor Grothendieck how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008 Gabor Grothendieck Can R fill in missing values? Jul 23, 2008 Gabor Grothendieck how to export ".xls" file with colorful cells? Jul 24, 2008 Gabor Grothendieck Create an R package Jul 24, 2008 Gabor Grothendieck Formatting Syntax when Merging Jul 25, 2008 Gabor Grothendieck plot zoo custom panel help Jul 25, 2008 Gabor Grothendieck Rolling range and regression calculations Jul 25, 2008 Gabor Grothendieck plot zoo custom panel help Jul 25, 2008 Gabor Grothendieck plot zoo custom panel help Jul 25, 2008 Gabor Grothendieck Data length mismatch. Jul 26, 2008 Gabor Grothendieck Data length mismatch. Jul 26, 2008 Gabor Grothendieck Data length mismatch. Jul 26, 2008 Gabor Grothendieck Data length mismatch. Jul 26, 2008 Gabor Grothendieck Data length mismatch. Jul 26, 2008 Gabor Grothendieck Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) Jul 27, 2008 Gabor Grothendieck Fill in NA values in vector with previous character/factor Jul 28, 2008 Gabor Grothendieck rollapply() opertation on time series Jul 28, 2008 Gabor Grothendieck rollapply() opertation on time series Jul 28, 2008 Gabor Grothendieck combining zoo series with an overlapping index? Jul 29, 2008 Gabor Grothendieck combining zoo series with an overlapping index? Jul 29, 2008 Gabor Grothendieck more environment questions Jul 29, 2008 Gabor Grothendieck more environment questions Jul 29, 2008 Gabor Grothendieck rollapply() opertation on time series Jul 29, 2008 Gabor Grothendieck rolling regression between adjacent columns Jul 29, 2008 Gabor Grothendieck rolling regression between adjacent columns Jul 30, 2008 Gabor Grothendieck Re gression between adjacent columns - error with NAs Jul 30, 2008 Gabor Grothendieck S 3 generic method consistency warning please help Jul 30, 2008 Gabor Grothendieck upgrade to 2.5 Jul 31, 2008 Gabor Grothendieck rollapply() to portions of a matrix Jul 31, 2008

Gabriela Cendoya

Last active: Jul 23, 2008
2 msgs
Gabriela Cendoya Using if, else statements Jul 23, 2008 Gabriela Cendoya Using if, else statements Jul 23, 2008

Gad Abraham

Last active: Jul 30, 2008
4 msgs
Gad Abraham Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Gad Abraham Legality Question about R's Open Source GNU GPL License Jul 29, 2008 Gad Abraham Legality Question about R's Open Source GNU GPL License Jul 29, 2008 Gad Abraham R command history -- can it be like Matlab's? Jul 30, 2008

Gary W

Last active: Jul 30, 2008
3 msgs
Gary W adding lines to multiple plots Jul 30, 2008 Gary W adding lines to multiple plot Jul 30, 2008 Gary W adding lines to multiple plot Jul 30, 2008

Gavin Simpson

Last active: Jul 30, 2008
21 msgs
Gavin Simpson Help in using PCR Jul 1, 2008 Gavin Simpson Help in using PCR Jul 1, 2008 Gavin Simpson Simulate from a GAM model Jul 1, 2008 Gavin Simpson Help in using PCR Jul 2, 2008 Gavin Simpson Otpmial initial centroid in kmeans Jul 3, 2008 Gavin Simpson randomForest.error: length of response must be the same as predictors Jul 3, 2008 Gavin Simpson apply with a division Jul 4, 2008 Gavin Simpson p-value for Nonmetric Multidimentional Scaling? Jul 5, 2008 Gavin Simpson help about random generation of a Normal distribution of several variables Jul 5, 2008 Gavin Simpson lattice smooth problem? Jul 6, 2008 Gavin Simpson initialize a factor vector Jul 13, 2008 Gavin Simpson name returned by lapply Jul 18, 2008 Gavin Simpson name returned by lapply Jul 18, 2008 Gavin Simpson source code functions Jul 18, 2008 Gavin Simpson Weighted variance function? Jul 24, 2008 Gavin Simpson Panel of pie charts Jul 29, 2008 Gavin Simpson Re peated Measure ANOVA-Old question Jul 30, 2008 Gavin Simpson Re creating Procrustes Plot in Lattice Jul 30, 2008 Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Gavin Simpson R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Gavin Simpson Re creating Procrustes Plot in Lattice Jul 30, 2008

Geoffrey Smith

Last active: Jul 2, 2008
1 msg
Geoffrey Smith survival package test stats Jul 2, 2008

Georg Ehret

Last active: Jul 10, 2008
1 msg
Georg Ehret number of effective tests Jul 10, 2008

Georg Otto

Last active: Jul 9, 2008
1 msg
Georg Otto Sweave figure Jul 9, 2008

Gerrit Draisma

Last active: Jul 30, 2008
1 msg
Gerrit Draisma Unexpected line type in lattice plot key on pdf device Jul 30, 2008

Giovanni Bacaro

Last active: Jul 8, 2008
1 msg
Giovanni Bacaro help for xvalid with external data Jul 8, 2008

Giovanni Petris

Last active: Jul 8, 2008
1 msg
Giovanni Petris Question: Beginner stuck in a R cycle Jul 8, 2008

Greg Kettler

Last active: Jul 3, 2008
1 msg
Greg Kettler apply with a division Jul 3, 2008

Greg Snow

Last active: Jul 23, 2008
16 msgs
Greg Snow Fitting a curve to data Jul 3, 2008 Greg Snow position legend below x-axis title Jul 3, 2008 Greg Snow L1 nonlinear approximation Jul 7, 2008 Greg Snow attributing values to dataframe positions following eval Jul 8, 2008 Greg Snow Question: Beginner stuck in a R cycle Jul 8, 2008 Greg Snow any way to set defaults for par? Jul 14, 2008 Greg Snow shapiro wilk normality test Jul 14, 2008 Greg Snow statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008 Greg Snow Histogram with two colors depending on condition Jul 17, 2008 Greg Snow TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 21, 2008 Greg Snow asp and ylim Jul 21, 2008 Greg Snow saving plot both as jpg and pdf Jul 22, 2008 Greg Snow normalised/transformed regressions Jul 22, 2008 Greg Snow normalised/transformed regressions Jul 22, 2008 Greg Snow tklistbox and extracting selection to R Jul 22, 2008 Greg Snow Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008

Gregoire Pau

Last active: Jul 31, 2008
1 msg
Gregoire Pau hwriter - Writing R objects in HTML format Jul 31, 2008

Gregor Gorjanc

Last active: Jul 8, 2008
1 msg
Gregor Gorjanc Automatic placement of Legends Jul 8, 2008

Gregory R. Warnes

Last active: Jul 18, 2008
5 msgs
Gregory R. Warnes Messge ``no visible binding''. Jul 1, 2008 Gregory R. Warnes REvolution computing Jul 18, 2008 Gregory R. Warnes RStat version 2.7.2 now available Jul 18, 2008 Gregory R. Warnes Correction: RStat version 2.7.*1* now available Jul 18, 2008 Gregory R. Warnes REvolution computing Jul 18, 2008

Gundala Viswanath

Last active: Jul 31, 2008
12 msgs
Gundala Viswanath Plotting Bi-Gamma Distribution Jul 1, 2008 Gundala Viswanath Plotting Bi-Gamma Distribution Jul 2, 2008 Gundala Viswanath Method for checking automatically which distribtions fits a data Jul 6, 2008 Gundala Viswanath Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008 Gundala Viswanath Howto Initialize Parameter of Gamma Mixture Densities for EM Jul 7, 2008 Gundala Viswanath Finding Values that Occur Most Often in a Vector Jul 9, 2008 Gundala Viswanath Meaning of Positive LogLikelihood Jul 11, 2008 Gundala Viswanath Howto view function's source code of an installed package Jul 16, 2008 Gundala Viswanath How to compute loglikelihood of Lognormal distribution Jul 17, 2008 Gundala Viswanath Howto Restart A Function with Try-Error Catch Jul 21, 2008 Gundala Viswanath Howto Draw Bimodal Gamma Curve with User Supplied Parameters Jul 29, 2008 Gundala Viswanath Identifying Points That Belongs to Components of Mixture Models Jul 31, 2008

Gunther Höning

Last active: Jul 1, 2008
2 msgs
Gunther Höning Regression and fitting Jul 1, 2008 Gunther Höning Regression and fitting Jul 1, 2008

Gustaf Rydevik

Last active: Jul 31, 2008
10 msgs
Gustaf Rydevik Migrating from S-Plus to R - Exporting Tables Jul 3, 2008 Gustaf Rydevik Question: Beginner stuck in a R cycle Jul 8, 2008 Gustaf Rydevik Non-normal data issues in PhD software engineering experiment Jul 10, 2008 Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Gustaf Rydevik [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 23, 2008 Gustaf Rydevik Simple... but... Jul 23, 2008 Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Gustaf Rydevik sequential sum of a vector... Jul 23, 2008 Gustaf Rydevik Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008

Gábor Csárdi

Last active: Jul 30, 2008
20 msgs
Gábor Csárdi trivial list question Jul 1, 2008 Gábor Csárdi Find classes of each column of data.frame() Jul 1, 2008 Gábor Csárdi Can R do this ? Jul 8, 2008 Gábor Csárdi Can R do this ? Jul 8, 2008 Gábor Csárdi Expression in axis Jul 9, 2008 Gábor Csárdi Summary Stats (not summary(x)) Jul 9, 2008 Gábor Csárdi Turn any vector Jul 10, 2008 Gábor Csárdi network Jul 11, 2008 Gábor Csárdi network Jul 11, 2008 Gábor Csárdi network Jul 11, 2008 Gábor Csárdi rm(l*) Jul 14, 2008 Gábor Csárdi Font quality in base graphics Jul 16, 2008 Gábor Csárdi Font quality in base graphics Jul 16, 2008 Gábor Csárdi Calculating Betweenness - Efficiency problem Jul 21, 2008 Gábor Csárdi Calculating Betweenness - Efficiency problem Jul 23, 2008 Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Gábor Csárdi NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Gábor Csárdi Help with rep Jul 25, 2008 Gábor Csárdi R -Legality Question about R's Open Source GNU GPL Licen Jul 30, 2008

Gérard Henry

Last active: Jul 24, 2008
1 msg
Gérard Henry unable to load a library Jul 24, 2008

Göran Broström

Last active: Jul 20, 2008
2 msgs
Göran Broström Likelihood ratio test between glm and glmer fits Jul 19, 2008 Göran Broström Parametric survival models with left truncated, right censored data Jul 20, 2008

H. Paul Benton

Last active: Jul 17, 2008
2 msgs
H. Paul Benton ubuntu and rgl package vs suse ?? static plots Jul 17, 2008 H. Paul Benton ubuntu and rgl package vs suse ?? static plots Jul 17, 2008

HBaize

Last active: Jul 23, 2008
3 msgs
HBaize RODBC Access limit? Jul 3, 2008 HBaize Summary Stats (not summary(x)) Jul 9, 2008 HBaize adding the mean and standard deviation to boxplots Jul 23, 2008

Hadley Wickham

Last active: Jul 31, 2008
45 msgs
Hadley Wickham ggplot2 legend for vertical lines Jul 3, 2008 Hadley Wickham ggplot2: scaling and tick mark of x-axis Jul 3, 2008 Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008 Hadley Wickham Repeated measures lme or anova Jul 6, 2008 Hadley Wickham What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Jul 6, 2008 Hadley Wickham Method for checking automatically which distribtions fits a data Jul 7, 2008 Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008 Hadley Wickham "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 7, 2008 Hadley Wickham Running "all possible subsets" of a GLM (binomial) model Jul 7, 2008 Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008 Hadley Wickham Colour clusters in a 2d plot Jul 7, 2008 Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008 Hadley Wickham Drawing a colour wheel - bug in hcl? Jul 7, 2008 Hadley Wickham Histogram with colors according to factor Jul 8, 2008 Hadley Wickham Port package Jul 9, 2008 Hadley Wickham Grid building in R Jul 9, 2008 Hadley Wickham Operator overloading Jul 10, 2008 Hadley Wickham Non-normal data issues in PhD software engineering experiment Jul 10, 2008 Hadley Wickham layout is to xyplot as ??? is to qplot Jul 10, 2008 Hadley Wickham data summerization etc... Jul 12, 2008 Hadley Wickham enscript states file for R scripts? Jul 15, 2008 Hadley Wickham Melt (reshape) question Jul 15, 2008 Hadley Wickham Histogram with two colors depending on condition Jul 17, 2008 Hadley Wickham Matching Up Values Jul 17, 2008 Hadley Wickham size and coding error in plot ? Jul 17, 2008 Hadley Wickham smooth.spline Jul 19, 2008 Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 Hadley Wickham TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 20, 2008 Hadley Wickham Lattice Version of grconvertX or variant on panel.text? Jul 20, 2008 Hadley Wickham Sum efficiently from large matrix according to re-occuring levels of factor? Jul 21, 2008 Hadley Wickham scatter plot using ggplot Jul 22, 2008 Hadley Wickham Plotting Multiple lines on one plot Jul 23, 2008 Hadley Wickham ggplot question Jul 24, 2008 Hadley Wickham melting a list: basic question Jul 25, 2008 Hadley Wickham melting a list: basic question Jul 25, 2008 Hadley Wickham melting a list: basic question Jul 27, 2008 Hadley Wickham A easy way to write formula Jul 27, 2008 Hadley Wickham Is there anyway to clip the bottom of a barplot? Jul 28, 2008 Hadley Wickham R command history -- can it be like Matlab's? Jul 29, 2008 Hadley Wickham R command history -- can it be like Matlab's? Jul 29, 2008 Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 30, 2008 Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 30, 2008 Hadley Wickham bug in 'margins' behavior in reshape - cast Jul 31, 2008 Hadley Wickham History pruning Jul 31, 2008

Hanke, Alex

Last active: Jul 8, 2008
1 msg
Hanke, Alex Sum(Random Numbers)=100 Jul 8, 2008

Hans W Borchers

Last active: Jul 25, 2008
9 msgs
Hans W Borchers Histogram with colors according to factor Jul 8, 2008 Hans W Borchers Histogram with colors according to factor Jul 8, 2008 Hans W Borchers principal factor analysis Jul 20, 2008 Hans W Borchers Non-linearly constrained optimisation Jul 20, 2008 Hans W Borchers Editor fpr Mac OS Jul 21, 2008 Hans W Borchers randomForest Tutorial Jul 22, 2008 Hans W Borchers How to get rule number in arules Jul 24, 2008 Hans W Borchers Coconut benchmark for R? Jul 24, 2008 Hans W Borchers Fit a 3-Dimensional Line to Data Points Jul 25, 2008

Hans-Jörg Bibiko

Last active: Jul 28, 2008
4 msgs
Hans-Jörg Bibiko variable as part of file name Jul 2, 2008 Hans-Jörg Bibiko Integrating R and Textmate Jul 25, 2008 Hans-Jörg Bibiko Converting english words to numeric equivalents Jul 28, 2008 Hans-Jörg Bibiko Converting english words to numeric equivalents Jul 28, 2008

Hans-Peter Suter

Last active: Jul 23, 2008
1 msg
Hans-Peter Suter Editor for Mac Jul 23, 2008

Hao Ren Sr

Last active: Jul 12, 2008
1 msg
Hao Ren Sr Error of exp() in a dll from Fortran Jul 12, 2008

Henning Wildhagen

Last active: Jul 28, 2008
7 msgs
Henning Wildhagen ggplot2: scaling and tick mark of x-axis Jul 3, 2008 Henning Wildhagen xYplot customizing y-axis scaling Jul 10, 2008 Henning Wildhagen barchart with bars attached to y=0-line Jul 16, 2008 Henning Wildhagen barchart with bars attached to y=0-line Jul 17, 2008 Henning Wildhagen t-test for multiple variables Jul 18, 2008 Henning Wildhagen t-test for multiple variables Jul 18, 2008 Henning Wildhagen axis.break on Date-x-axis in lattice xyplot Jul 28, 2008

Henrik Bengtsson

Last active: Jul 28, 2008
12 msgs
Henrik Bengtsson Change in behaviour of sd() Jul 8, 2008 Henrik Bengtsson Computing row means for sets of 2 columns Jul 13, 2008 Henrik Bengtsson counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008 Henrik Bengtsson Location of HTML help files Jul 16, 2008 Henrik Bengtsson Help with rearranging data Jul 22, 2008 Henrik Bengtsson Flip Matrix form file? Jul 23, 2008 Henrik Bengtsson Combining 4th column from 30 files Jul 23, 2008 Henrik Bengtsson Remove non-numerical columns from data frame Jul 26, 2008 Henrik Bengtsson Are there any packages that can process images other than pixelmap (i.e. pnm)? Jul 27, 2008 Henrik Bengtsson Case statements in R Jul 28, 2008 Henrik Bengtsson Case statements in R Jul 28, 2008 Henrik Bengtsson Is there a way to avoid loading dependendent packages? Jul 28, 2008

Henrique Dallazuanna

Last active: Jul 26, 2008
50 msgs
Henrique Dallazuanna Find classes of each column of data.frame() Jul 1, 2008 Henrique Dallazuanna trivial list question Jul 1, 2008 Henrique Dallazuanna ignore warning messages? Jul 1, 2008 Henrique Dallazuanna plot window Jul 1, 2008 Henrique Dallazuanna variable as part of file name Jul 2, 2008 Henrique Dallazuanna exporting ftable Jul 2, 2008 Henrique Dallazuanna multiplication question Jul 2, 2008 Henrique Dallazuanna multiplication question Jul 2, 2008 Henrique Dallazuanna Re membering the last time an event occurred within a dataframe Jul 3, 2008 Henrique Dallazuanna subset function within a function Jul 3, 2008 Henrique Dallazuanna apply with a division Jul 3, 2008 Henrique Dallazuanna A quick question about lm() Jul 7, 2008 Henrique Dallazuanna subset() multiple arguments Jul 7, 2008 Henrique Dallazuanna Find the closest value in a list or matrix Jul 9, 2008 Henrique Dallazuanna randomly select duplicated entries Jul 9, 2008 Henrique Dallazuanna Turn any vector Jul 10, 2008 Henrique Dallazuanna Position in a vector of the last value > n Jul 10, 2008 Henrique Dallazuanna While loop Jul 11, 2008 Henrique Dallazuanna List help Jul 11, 2008 Henrique Dallazuanna options() question for displaying numbers in the GUI Jul 14, 2008 Henrique Dallazuanna aggregate months to years Jul 14, 2008 Henrique Dallazuanna A question about using function plot Jul 14, 2008 Henrique Dallazuanna Exporting an list() Jul 15, 2008 Henrique Dallazuanna POSIXct extract time Jul 15, 2008 Henrique Dallazuanna Output design question Jul 16, 2008 Henrique Dallazuanna help with data layout Jul 17, 2008 Henrique Dallazuanna only "T" becomes logical colum with read.table Jul 18, 2008 Henrique Dallazuanna source code functions Jul 18, 2008 Henrique Dallazuanna creating names for lists Jul 18, 2008 Henrique Dallazuanna cbind help Jul 18, 2008 Henrique Dallazuanna re ad and check table Jul 18, 2008 Henrique Dallazuanna How to cut data elements included in a text line Jul 18, 2008 Henrique Dallazuanna using which to identify a range of values Jul 18, 2008 Henrique Dallazuanna vector help Jul 21, 2008 Henrique Dallazuanna lattice with bwplot Jul 21, 2008 Henrique Dallazuanna y-axis number format on plot, barplot etc. Jul 22, 2008 Henrique Dallazuanna Reading the data from specific columns Jul 22, 2008 Henrique Dallazuanna par() function does not work Jul 23, 2008 Henrique Dallazuanna Combining 4th column from 30 files Jul 23, 2008 Henrique Dallazuanna Simple... but... Jul 23, 2008 Henrique Dallazuanna Convert list of lists <--> data frame Jul 23, 2008 Henrique Dallazuanna sequential sum of a vector... Jul 23, 2008 Henrique Dallazuanna Convert list of lists <--> data frame Jul 23, 2008 Henrique Dallazuanna Histogram Jul 23, 2008 Henrique Dallazuanna sum each row and output results Jul 23, 2008 Henrique Dallazuanna convert a vector of words into a matrix Jul 24, 2008 Henrique Dallazuanna How to delete duplicate cases? Jul 24, 2008 Henrique Dallazuanna factor question Jul 24, 2008 Henrique Dallazuanna Building a data frame with missing data Jul 25, 2008 Henrique Dallazuanna Remove non-numerical columns from data frame Jul 26, 2008

Hervé Pagès

Last active: Jul 9, 2008
1 msg
Hervé Pagès Finding Values that Occur Most Often in a Vector Jul 9, 2008

Hohm, Dale

Last active: Jul 13, 2008
4 msgs
Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 12, 2008 Hohm, Dale Reading Multi-value data fields for descriptive analysis (resend) Jul 12, 2008 Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 12, 2008 Hohm, Dale Reading Multi-value data fields for descriptive analysis Jul 13, 2008

Horace Tso

Last active: Jul 23, 2008
1 msg
Horace Tso Constrained coefficients in lm (correction) Jul 23, 2008

Hsin-Ya Lee

Last active: Jul 1, 2008
1 msg
Hsin-Ya Lee Problems with lm() Jul 1, 2008

Hua Li

Last active: Jul 14, 2008
5 msgs
Hua Li ignore warning messages? Jul 1, 2008 Hua Li ignore warning messages? Jul 6, 2008 Hua Li color with tcl/tk? Jul 6, 2008 Hua Li position of a specific character Jul 14, 2008 Hua Li position of a specific character Jul 14, 2008

Humberto Dutra

Last active: Jul 3, 2008
1 msg
Humberto Dutra post hoc comparisons on NLME for longitudinal data Jul 3, 2008

Hyunseung Kang

Last active: Jul 10, 2008
2 msgs
Hyunseung Kang Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008 Hyunseung Kang Help on Installing Matrix Package in Linux (Fedora) Jul 10, 2008

INSEED statistics workshop

Last active: Jul 15, 2008
2 msgs
INSEED statistics workshop INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R Jul 15, 2008 INSEED statistics workshop INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R) Jul 15, 2008

Iain Gallagher

Last active: Jul 17, 2008
3 msgs
Iain Gallagher Another failed attempt to install an R package in Ubuntu Jul 12, 2008 Iain Gallagher help with data layout Jul 17, 2008 Iain Gallagher Help with data layout - Thanks Jul 17, 2008

Iasonas Lamprianou

Last active: Jul 31, 2008
2 msgs
Iasonas Lamprianou stats question Jul 30, 2008 Iasonas Lamprianou stats question Jul 31, 2008

Imanpreet

Last active: Jul 24, 2008
2 msgs
Imanpreet Benchmarking R and R Workloads Jul 6, 2008 Imanpreet Coconut benchmark for R? Jul 24, 2008

Indermaur Lukas

Last active: Jul 29, 2008
1 msg
Indermaur Lukas biplot_group_colours_and_point_symbols Jul 29, 2008

Isabella Ghement

Last active: Jul 8, 2008
1 msg
Isabella Ghement Gage R & R Jul 8, 2008

Ivar Herfindal

Last active: Jul 15, 2008
1 msg
Ivar Herfindal Supressing printing from a function: ecdf Jul 15, 2008

J S

Last active: Jul 7, 2008
3 msgs
J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 4, 2008 J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 5, 2008 J S Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 7, 2008

J.delasHeras at ed.ac.uk

Last active: Jul 25, 2008
2 msgs
J.delasHeras at ed.ac.uk Saving a workspace with "extras"? Jul 25, 2008 J.delasHeras at ed.ac.uk Saving a workspace with "extras"? Jul 25, 2008

Jackson,Daniel

Last active: Jul 14, 2008
1 msg
Jackson,Daniel Can't compile in HPUX 11.31 on IA64 Jul 14, 2008

Jacob Wegelin

Last active: Jul 31, 2008
3 msgs
Jacob Wegelin nested calls, variable scope Jul 17, 2008 Jacob Wegelin nested calls, variable scope Jul 17, 2008 Jacob Wegelin dput vs unclass to see what a factor really is composed of Jul 31, 2008

Jan Smit

Last active: Jul 16, 2008
2 msgs
Jan Smit Location of HTML help files Jul 16, 2008 Jan Smit Location of HTML help files Jul 16, 2008

Jan de Leeuw

Last active: Jul 12, 2008
1 msg
Jan de Leeuw R-outlet: Journal of Statistical Software Jul 12, 2008

Jan.Verbesselt at csiro.au

Last active: Jul 1, 2008
1 msg
Jan.Verbesselt at csiro.au Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008

Janet Young

Last active: Jul 18, 2008
1 msg
Janet Young problem with putting text in outer margins (mtext outer=TRUE) Jul 18, 2008

Januarius

Last active: Jul 11, 2008
2 msgs
Januarius Funnel plots in r Jul 11, 2008 Januarius Funnel plots Jul 11, 2008

Jarekj

Last active: Jul 23, 2008
2 msgs
Jarekj Sample on dataframe Jul 23, 2008 Jarekj Sample on dataframe Jul 23, 2008

Jason Lee

Last active: Jul 17, 2008
10 msgs
Jason Lee Help in using PCR Jun 30, 2008 Jason Lee Query on packages for Emerging Patterns Jul 1, 2008 Jason Lee Help in using PCR Jul 1, 2008 Jason Lee Problem in installing Biobase Jul 4, 2008 Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008 Jason Lee How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 6, 2008 Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 15, 2008 Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 16, 2008 Jason Lee How to extract component number of RMSEP in RMSEP plot Jul 16, 2008 Jason Lee How to convert/map jacktest results to dataframe or file Jul 17, 2008

Jason Liao

Last active: Jul 14, 2008
1 msg
Jason Liao A question about using function plot Jul 14, 2008

Javier Garcia-Pintado

Last active: Jul 10, 2008
3 msgs
Javier Garcia-Pintado extracting elements from a list in vectorized form Jul 1, 2008 Javier Garcia-Pintado extracting elements from a list in vectorized form Jul 1, 2008 Javier Garcia-Pintado Turn any vector Jul 10, 2008

Jay Douillard

Last active: Jul 30, 2008
1 msg
Jay Douillard Setting fixed size for segement plot using stars() (axes size vs print size) Jul 30, 2008

Jeff Newmiller

Last active: Jul 15, 2008
1 msg
Jeff Newmiller Iterations Jul 15, 2008

Jeffrey Horner

Last active: Jul 31, 2008
5 msgs
Jeffrey Horner Font quality in base graphics Jul 15, 2008 Jeffrey Horner Should this PDF render correctly without font embedding? Jul 24, 2008 Jeffrey Horner ANNOUNCE: rapache 1.1.0 release Jul 24, 2008 Jeffrey Horner environment question Jul 28, 2008 Jeffrey Horner 'system' command through Rserve Jul 31, 2008

Jeffrey J. Hallman

Last active: Jul 8, 2008
1 msg
Jeffrey J. Hallman time series by calendar week Jul 8, 2008

Jeffrey S. Racine

Last active: Jul 25, 2008
1 msg
Jeffrey S. Racine Package np version 0.20-0 released to CRAN Jul 25, 2008

Jeffrey_Bromaghin at fws.gov

Last active: Jul 25, 2008
1 msg
Jeffrey_Bromaghin at fws.gov Percentile Estimation From Kernel Density Estimate Jul 25, 2008

Jenny Sun

Last active: Jul 2, 2008
2 msgs
Jenny Sun NLME questions -- interpretation of results Jul 2, 2008 Jenny Sun NLME questions -- interpretation of results Jul 2, 2008

Jens Oldeland

Last active: Jul 30, 2008
1 msg
Jens Oldeland problem with nested loops Jul 30, 2008

Jeremy MAZET

Last active: Jul 15, 2008
1 msg
Jeremy MAZET DOE for logistic models Jul 15, 2008

Jeroen Ooms

Last active: Jul 27, 2008
3 msgs
Jeroen Ooms set type of SS in anova() Jul 4, 2008 Jeroen Ooms Link functions in SEM Jul 27, 2008 Jeroen Ooms Object-oriented programming in R for Java programmers? Jul 27, 2008

Jia Ying Mei

Last active: Jul 31, 2008
15 msgs
Jia Ying Mei How to.... Jul 22, 2008 Jia Ying Mei Can't Load Text Files Jul 22, 2008 Jia Ying Mei How to.... Jul 23, 2008 Jia Ying Mei Can't Load Text Files Jul 23, 2008 Jia Ying Mei Can R fill in missing values? Jul 23, 2008 Jia Ying Mei Formatting Syntax when Merging Jul 24, 2008 Jia Ying Mei How to.... Jul 24, 2008 Jia Ying Mei How to.... Jul 24, 2008 Jia Ying Mei Marking Interval Length Jul 26, 2008 Jia Ying Mei Marking Interval Length Jul 26, 2008 Jia Ying Mei Analyzing Intervals between Data Jul 26, 2008 Jia Ying Mei Analyzing Intervals between Data Jul 26, 2008 Jia Ying Mei Percent Change After Each Interval Jul 30, 2008 Jia Ying Mei Rearranging Data Jul 30, 2008 Jia Ying Mei Rearranging Data Jul 31, 2008

Jiangtian Li

Last active: Jul 22, 2008
1 msg
Jiangtian Li help on R benchmarks Jul 22, 2008

Jim Lemon

Last active: Jul 31, 2008
34 msgs
Jim Lemon Add comments on plot window Jul 1, 2008 Jim Lemon W-E-I-R-D Weird! Jul 2, 2008 Jim Lemon get formatted regression output Jul 3, 2008 Jim Lemon help appreciated to make a plot Jul 3, 2008 Jim Lemon indicating significant differences in boxplots Jul 7, 2008 Jim Lemon Change in behaviour of sd() Jul 9, 2008 Jim Lemon Automatic placement of Legends Jul 9, 2008 Jim Lemon recursively divide a value to get a sequence Jul 9, 2008 Jim Lemon Grid building in R Jul 10, 2008 Jim Lemon rounding Jul 11, 2008 Jim Lemon Plot multiple datasets on a VCD ternary graph Jul 12, 2008 Jim Lemon plotting granular data Jul 12, 2008 Jim Lemon Off topic: Tcl/Tk outside R. Jul 15, 2008 Jim Lemon Convert data set to data frame Jul 15, 2008 Jim Lemon Exporting an list() Jul 15, 2008 Jim Lemon Mapping data onto 1-10 score Jul 15, 2008 Jim Lemon Row Sum, exclude positive values Jul 15, 2008 Jim Lemon spliting a string Jul 17, 2008 Jim Lemon drawing segments through points with pch=1 Jul 21, 2008 Jim Lemon alternate usage of soil.texture (plotrix) Jul 22, 2008 Jim Lemon How to.... Jul 23, 2008 Jim Lemon Decoding subscripts/superscripts from CSVs Jul 23, 2008 Jim Lemon Using PrettyR to produce LaTeX output Jul 24, 2008 Jim Lemon Bug in gap.plot Jul 25, 2008 Jim Lemon Relying on R to generate html tables with hyperlinks and pictures ? Jul 25, 2008 Jim Lemon Dividing by 0 Jul 25, 2008 Jim Lemon Matrix barplot Jul 25, 2008 Jim Lemon axis.break on Date-x-axis in lattice xyplot Jul 28, 2008 Jim Lemon how to add notes to the graph? Jul 29, 2008 Jim Lemon Is there way to multiple plots on gap.plot? Jul 29, 2008 Jim Lemon Is there way to multiple plots on gap.plot? Jul 29, 2008 Jim Lemon table questions Jul 30, 2008 Jim Lemon placing a text in the corner of a plot Jul 30, 2008 Jim Lemon combinations with replications Jul 31, 2008

Jim Porzak

Last active: Jul 28, 2008
9 msgs
Jim Porzak Problem reading a CSV Jul 1, 2008 Jim Porzak Interest in a Use R Group in San Francisco area? Jul 7, 2008 Jim Porzak odfWeave problem in 7.1? Jul 10, 2008 Jim Porzak odfWeave problem in 7.1? Jul 10, 2008 Jim Porzak odfWeave problem in 7.1? Jul 11, 2008 Jim Porzak randomForest Tutorial Jul 22, 2008 Jim Porzak Simple... but... Jul 23, 2008 Jim Porzak RODBC to query an Oracle table Jul 28, 2008 Jim Porzak Legality Question about R's Open Source GNU GPL License Jul 28, 2008

Jim Price

Last active: Jul 10, 2008
3 msgs
Jim Price Re membering the last time an event occurred within a dataframe Jul 3, 2008 Jim Price Re membering the last time an event occurred within a dataframe Jul 3, 2008 Jim Price layout is to xyplot as ??? is to qplot Jul 10, 2008

Jin Wang

Last active: Jul 16, 2008
2 msgs
Jin Wang implementation of Prentice method in cch() Jul 15, 2008 Jin Wang 回复: cch() and coxph() for case-cohort Jul 16, 2008

Jinsong Zhao

Last active: Jul 27, 2008
4 msgs
Jinsong Zhao principal factor analysis Jul 19, 2008 Jinsong Zhao response surface analysis Jul 26, 2008 Jinsong Zhao A easy way to write formula Jul 27, 2008 Jinsong Zhao response surface analysis Jul 27, 2008

Joerg van den Hoff

Last active: Jul 8, 2008
1 msg
Joerg van den Hoff one-site competition data // curve fitting Jul 8, 2008

Johannes Hüsing

Last active: Jul 27, 2008
19 msgs
Johannes Hüsing Sunset in Dortmund Jul 2, 2008 Johannes Hüsing Sunset in Dortmund Jul 3, 2008 Johannes Hüsing Interpreting messages when building packages Jul 6, 2008 Johannes Hüsing Interpreting messages when building packages Jul 7, 2008 Johannes Hüsing Interpreting messages when building packages Jul 7, 2008 Johannes Hüsing Interpreting messages when building packages Jul 7, 2008 Johannes Hüsing Interpreting messages when building packages Jul 7, 2008 Johannes Hüsing Another packaging question Jul 11, 2008 Johannes Hüsing Another packaging question Jul 13, 2008 Johannes Hüsing initialize a factor vector Jul 13, 2008 Johannes Hüsing initialize a factor vector Jul 13, 2008 Johannes Hüsing shapiro wilk normality test Jul 13, 2008 Johannes Hüsing shapiro wilk normality test Jul 13, 2008 Johannes Hüsing Landscape mode for pdf Jul 18, 2008 Johannes Hüsing initialize a factor vector Jul 19, 2008 Johannes Hüsing Discretize continous variables.... Jul 19, 2008 Johannes Hüsing Discretize continous variables.... Jul 20, 2008 Johannes Hüsing Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Johannes Hüsing Object-oriented programming in R for Java programmers? Jul 27, 2008

John C Frain

Last active: Jul 11, 2008
1 msg
John C Frain Start preferred RGui Jul 11, 2008

John Coulthard

Last active: Jul 4, 2008
1 msg
John Coulthard Repeated measures lme or anova Jul 4, 2008

John Fox

Last active: Jul 28, 2008
6 msgs
John Fox Recoding a variable Jul 3, 2008 John Fox set type of SS in anova() Jul 5, 2008 John Fox Change language in Rcmdr Jul 7, 2008 John Fox sem & testing multiple hypotheses with BIC Jul 24, 2008 John Fox Link functions in SEM Jul 28, 2008 John Fox help with durbin.watson Jul 28, 2008

John James

Last active: Jul 25, 2008
1 msg
John James Selecting the first measurement only from a longitudinal sequence Jul 25, 2008

John Kane

Last active: Jul 31, 2008
18 msgs
John Kane Data size Jul 3, 2008 John Kane Sunset in Dortmund Jul 3, 2008 John Kane indicating significant differences in boxplots Jul 7, 2008 John Kane attributing values to dataframe positions following eval Jul 8, 2008 John Kane How I count the all possible samples?? Jul 8, 2008 John Kane Help with error in "if then" statement Jul 12, 2008 John Kane R Commander question Jul 14, 2008 John Kane long data frame selection error Jul 15, 2008 John Kane Subsetting data by date Jul 21, 2008 John Kane Subsetting data by date Jul 21, 2008 John Kane How to filter a data frame? Jul 22, 2008 John Kane How to filter a data frame? Jul 22, 2008 John Kane adding the mean and standard deviation to boxplots Jul 23, 2008 John Kane Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008 John Kane Panel of pie charts Jul 29, 2008 John Kane writing the plots Jul 29, 2008 John Kane Random subset Jul 30, 2008 John Kane Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008

John Maindonald

Last active: Jul 26, 2008
1 msg
John Maindonald Dividing by 0 Jul 26, 2008

John Smith

Last active: Jul 22, 2008
3 msgs
John Smith how to draw multiples curses (for given formulae) in lattice Jul 21, 2008 John Smith Lattice: How to draw curves from given formulae Jul 21, 2008 John Smith Lattice: How to draw curves from given formulae Jul 22, 2008

John Sorkin

Last active: Jul 8, 2008
2 msgs
John Sorkin Can I do regression by steps? Jul 8, 2008 John Sorkin Can I do regression by steps? Jul 8, 2008

John Theal

Last active: Jul 23, 2008
1 msg
John Theal Time series reliability questions Jul 23, 2008

Johnson, Eric A. (Seattle)

Last active: Jul 31, 2008
1 msg
Johnson, Eric A. (Seattle) sort rows of matrix by rows of another matrix Jul 31, 2008

Jon Hak

Last active: Jul 21, 2008
4 msgs
Jon Hak manipulate a matrix2 Jul 18, 2008 Jon Hak manipulate a matrix2 Jul 21, 2008 Jon Hak manipulate a matrix2 Jul 21, 2008 Jon Hak manipulate a matrix2 Jul 21, 2008

Jon Olav Skoien

Last active: Jul 15, 2008
1 msg
Jon Olav Skoien manipulating (extracting) data from distance matrices Jul 15, 2008

Jon Zadra

Last active: Jul 18, 2008
2 msgs
Jon Zadra A shorter version of ".Last.value"? Jul 7, 2008 Jon Zadra Functions similar to step() and all.effects() that work for lme() objects? Jul 18, 2008

Jorge Ivan Velez

Last active: Jul 31, 2008
38 msgs
Jorge Ivan Velez ignore warning messages? Jul 1, 2008 Jorge Ivan Velez Ignore blank columns when reading a row from a table Jul 1, 2008 Jorge Ivan Velez is there an equivalent of prop.table but for counts Jul 1, 2008 Jorge Ivan Velez is there an equivalent of prop.table but for counts Jul 1, 2008 Jorge Ivan Velez Problem reading from a data frame Jul 2, 2008 Jorge Ivan Velez help on list comparison Jul 2, 2008 Jorge Ivan Velez problem with lm and predict - no predictions made Jul 2, 2008 Jorge Ivan Velez PCA on image data Jul 3, 2008 Jorge Ivan Velez PCA on image data Jul 3, 2008 Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008 Jorge Ivan Velez Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008 Jorge Ivan Velez Colour clusters in a 2d plot Jul 7, 2008 Jorge Ivan Velez Basic Vector and Matrix Operations Jul 7, 2008 Jorge Ivan Velez question on lm or glm matrix of coeficients X test data terms Jul 7, 2008 Jorge Ivan Velez Question: Beginner stuck in a R cycle Jul 8, 2008 Jorge Ivan Velez How I count the all possible samples?? Jul 8, 2008 Jorge Ivan Velez sorting a data frame by rownames Jul 8, 2008 Jorge Ivan Velez Summary Stats (not summary(x)) Jul 9, 2008 Jorge Ivan Velez Find the closest value in a list or matrix Jul 9, 2008 Jorge Ivan Velez Sorting a matrix Jul 10, 2008 Jorge Ivan Velez List help Jul 11, 2008 Jorge Ivan Velez Exporting an list() Jul 15, 2008 Jorge Ivan Velez extracting elements from print object of Manova() Jul 15, 2008 Jorge Ivan Velez Row Sum, exclude positive values Jul 15, 2008 Jorge Ivan Velez How to cut data elements included in a text line Jul 18, 2008 Jorge Ivan Velez with lapply() how can you retrieve the name of the object Jul 18, 2008 Jorge Ivan Velez with lapply() how can you retrieve the name of the object Jul 18, 2008 Jorge Ivan Velez vector help Jul 21, 2008 Jorge Ivan Velez Simple... but... Jul 23, 2008 Jorge Ivan Velez sequential sum of a vector... Jul 23, 2008 Jorge Ivan Velez Convert list of lists <--> data frame Jul 23, 2008 Jorge Ivan Velez Constrained coefficients in lm Jul 23, 2008 Jorge Ivan Velez Constrained coefficients in lm (correction) Jul 23, 2008 Jorge Ivan Velez How to delete duplicate cases? Jul 24, 2008 Jorge Ivan Velez product of successive rows Jul 29, 2008 Jorge Ivan Velez placing a text in the corner of a plot Jul 29, 2008 Jorge Ivan Velez Random number generation Jul 31, 2008 Jorge Ivan Velez Grouping Index of Matrix Based on Certain Condition Jul 31, 2008

Jos Kaefer

Last active: Jul 9, 2008
1 msg
Jos Kaefer Port package Jul 9, 2008

Jose Iparraguirre D'Elia

Last active: Jul 22, 2008
4 msgs
Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008 Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008 Jose Iparraguirre D'Elia Reading SPSS .por files Jul 18, 2008 Jose Iparraguirre D'Elia Reading SPSS .por files Jul 22, 2008

Josep Maria Campanera Alsina

Last active: Jul 7, 2008
2 msgs
Josep Maria Campanera Alsina Usage of rJava (.jcall) with Weka functions, any example? Jul 2, 2008 Josep Maria Campanera Alsina Colour clusters in a 2d plot Jul 7, 2008

Joseph Retzer

Last active: Jul 26, 2008
2 msgs
Joseph Retzer Thin frame line around R pdf output in LaTeX Jul 25, 2008 Joseph Retzer Thin frame line around R pdf output in LaTeX Jul 26, 2008

Josiah Walker

Last active: Jul 20, 2008
1 msg
Josiah Walker RODBC - problems using odbcDriverConnect without DSN Jul 20, 2008

José Augusto Jr.

Last active: Jul 22, 2008
7 msgs
José Augusto Jr. Erro updating HTML package descriptions in packages.html Jul 20, 2008 José Augusto Jr. Erro updating HTML package descriptions in packages.html Jul 20, 2008 José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 20, 2008 José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008 José Augusto Jr. portfolio optimization problem - use R Jul 21, 2008 José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008 José Augusto Jr. Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008

José Ignacio Bustos Melo

Last active: Jul 3, 2008
3 msgs
José Ignacio Bustos Melo R-help Digest, Vol 65, Issue 4 Jul 3, 2008 José Ignacio Bustos Melo R-help Digest, Vol 65, Issue 4 Jul 3, 2008 José Ignacio Bustos Melo Relative Mortality Risk second part Jul 3, 2008

Juan Pablo Romero Méndez

Last active: Jul 9, 2008
1 msg
Juan Pablo Romero Méndez Parallel R Jul 9, 2008

Judith Flores

Last active: Jul 22, 2008
4 msgs
Judith Flores What package to use to create a GUI Jul 15, 2008 Judith Flores Function to verify existence of an R object Jul 16, 2008 Judith Flores Retrieving data from a tcl /tk function Jul 18, 2008 Judith Flores tklistbox and extracting selection to R Jul 22, 2008

Julian Burgos

Last active: Jul 21, 2008
2 msgs
Julian Burgos using which to identify a range of values Jul 18, 2008 Julian Burgos Mclust - which cluster is each observation in? Jul 21, 2008

Juliane Struve

Last active: Jul 21, 2008
2 msgs
Juliane Struve sampling from a list of values while excluding one Jul 21, 2008 Juliane Struve sampling from a list of values while excluding one Jul 21, 2008

Juliet Hannah

Last active: Jul 13, 2008
3 msgs
Juliet Hannah read.table, NA assignment, and sep Jul 3, 2008 Juliet Hannah randomly select duplicated entries Jul 9, 2008 Juliet Hannah how do I read only specific columns using read.csv or other read function Jul 13, 2008

Julio Rojas

Last active: Jul 28, 2008
2 msgs
Julio Rojas Chi-square parameter estimation Jul 25, 2008 Julio Rojas Rv: Chi-square parameter estimation Jul 28, 2008

Jörg Groß

Last active: Jul 29, 2008
6 msgs
Jörg Groß Sorting / editing a table Jul 10, 2008 Jörg Groß stem and leaf plot: how to edit the stem-values Jul 13, 2008 Jörg Groß How to simulate heteroscedasticity (correlation) Jul 22, 2008 Jörg Groß placing a text in the corner of a plot Jul 29, 2008 Jörg Groß placing a text in the corner of a plot Jul 29, 2008 Jörg Groß how to get the position of a vector-value Jul 29, 2008

Kanak Choudhury

Last active: Jul 8, 2008
1 msg
Kanak Choudhury Constrained optimization Jul 8, 2008

Kaposi-Novak, Pal

Last active: Jul 23, 2008
2 msgs
Kaposi-Novak, Pal average replicate probe values Jul 22, 2008 Kaposi-Novak, Pal average replicate probe values Jul 23, 2008

Karin Lagesen

Last active: Jul 2, 2008
1 msg
Karin Lagesen conversion of data for use within barchart Jul 2, 2008

Karl Ove Hufthammer

Last active: Jul 28, 2008
1 msg
Karl Ove Hufthammer Percentile Estimation From Kernel Density Estimate Jul 28, 2008

Kate

Last active: Jul 16, 2008
1 msg
Kate Forecasting enrollments with fuzzy time series Jul 16, 2008

Katharine Mullen

Last active: Jul 29, 2008
3 msgs
Katharine Mullen nls and "plinear" algorithm Jul 8, 2008 Katharine Mullen Port package Jul 9, 2008 Katharine Mullen how to get the position of a vector-value Jul 29, 2008

Kathi

Last active: Jul 2, 2008
1 msg
Kathi Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008

Keith Jewell

Last active: Jul 11, 2008
3 msgs
Keith Jewell recursively divide a value to get a sequence Jul 9, 2008 Keith Jewell Start preferred RGui Jul 11, 2008 Keith Jewell Start preferred RGui Jul 11, 2008

Keith Ponting

Last active: Jul 31, 2008
1 msg
Keith Ponting Location of HTML help files Jul 31, 2008

Keld J?rn Simonsen

Last active: Jul 4, 2008
1 msg
Keld J?rn Simonsen problem with NA and if Jul 4, 2008

Keld Jørn Simonsen

Last active: Jul 3, 2008
4 msgs
Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 2, 2008 Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 3, 2008 Keld Jørn Simonsen problem with lm and predict - no predictions made Jul 3, 2008 Keld Jørn Simonsen problem with NA and if Jul 3, 2008

Ken Knoblauch

Last active: Jul 15, 2008
2 msgs
Ken Knoblauch building experimental paradigm with R as "Brainard/Pelli PsychToolbox" Jul 9, 2008 Ken Knoblauch counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008

Ken Williams

Last active: Jul 31, 2008
4 msgs
Ken Williams History pruning Jul 30, 2008 Ken Williams History pruning Jul 31, 2008 Ken Williams History pruning Jul 31, 2008 Ken Williams History pruning Jul 31, 2008

Kenn Konstabel

Last active: Jul 30, 2008
8 msgs
Kenn Konstabel lm and NA Jul 1, 2008 Kenn Konstabel trivial list question Jul 1, 2008 Kenn Konstabel multiplication question Jul 2, 2008 Kenn Konstabel Sum(Random Numbers)=100 Jul 8, 2008 Kenn Konstabel Manipulate Data (with regular expressions) Jul 11, 2008 Kenn Konstabel Subsetting an array by a vector of dimensions Jul 11, 2008 Kenn Konstabel Subsetting an array by a vector of dimensions Jul 24, 2008 Kenn Konstabel problem with nested loops Jul 30, 2008

Kenneth Cabrera

Last active: Jul 14, 2008
2 msgs
Kenneth Cabrera Insurance review statistical methods Jul 14, 2008 Kenneth Cabrera [Fwd: Re: Insurance review statistical methods] Jul 14, 2008

Kerpel, John

Last active: Jul 2, 2008
2 msgs
Kerpel, John Multiple time series plots Jul 2, 2008 Kerpel, John Multiple time series plots Jul 2, 2008

Kevin J Emerson

Last active: Jul 14, 2008
1 msg
Kevin J Emerson modeling binary response variables Jul 14, 2008

Kevin Wright

Last active: Jul 28, 2008
1 msg
Kevin Wright how to export ".xls" file with colorful cells? Jul 28, 2008

Kiran Annaiah

Last active: Jul 30, 2008
1 msg
Kiran Annaiah Hello, Jul 30, 2008

Korn, Ed (NIH/NCI) [E]

Last active: Jul 10, 2008
1 msg
Korn, Ed (NIH/NCI) [E] rounding Jul 10, 2008

Krzysztof Sakrejda

Last active: Jul 30, 2008
2 msgs
Krzysztof Sakrejda Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008 Krzysztof Sakrejda Re gression between adjacent columns - error with NAs Jul 30, 2008

Kumudan

Last active: Jul 25, 2008
1 msg
Kumudan Error in vector("double", length) Jul 25, 2008

Kunio takezawa

Last active: Jul 26, 2008
1 msg
Kunio takezawa gam() of package "mgcv" and anova() Jul 26, 2008

Kunzler, Andreas

Last active: Jul 24, 2008
8 msgs
Kunzler, Andreas Manipulate Data (with regular expressions) Jul 8, 2008 Kunzler, Andreas Manipulate Data (with regular expressions) Jul 11, 2008 Kunzler, Andreas Frequency-Table on Group Level - Multi Level Analysis Jul 14, 2008 Kunzler, Andreas Group level frequencies Jul 16, 2008 Kunzler, Andreas calculate differences - strange outcome Jul 17, 2008 Kunzler, Andreas Table orderd by frequencies Jul 22, 2008 Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Kunzler, Andreas NAs - NAs are not allowed in subscripted assignments Jul 24, 2008

Kurapati, Ravichandra (Ravichandra)

Last active: Jul 30, 2008
5 msgs
Kurapati, Ravichandra (Ravichandra) RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008 Kurapati, Ravichandra (Ravichandra) spliting a string Jul 17, 2008 Kurapati, Ravichandra (Ravichandra) how to split the string Jul 17, 2008 Kurapati, Ravichandra (Ravichandra) how know the status of particular process Jul 24, 2008 Kurapati, Ravichandra (Ravichandra) need some help Jul 30, 2008

Kyeongmi Cheon

Last active: Jul 24, 2008
1 msg
Kyeongmi Cheon nlminb--lower bound for parameters are dependent on each others Jul 24, 2008

L. Jay Roberts

Last active: Jul 16, 2008
1 msg
L. Jay Roberts Help with rpart.predict? Jul 16, 2008

Lan Wei

Last active: Jul 12, 2008
2 msgs
Lan Wei a warning message from lmer Jul 12, 2008 Lan Wei a warning message from lmer Jul 12, 2008

Lana Schaffer

Last active: Jul 3, 2008
2 msgs
Lana Schaffer adding a package in Windows Jul 1, 2008 Lana Schaffer subset function within a function Jul 3, 2008

Laura Poggio

Last active: Jul 2, 2008
2 msgs
Laura Poggio variable as part of file name Jul 2, 2008 Laura Poggio variable as part of file name Jul 2, 2008

Lauri Nikkinen

Last active: Jul 7, 2008
2 msgs
Lauri Nikkinen Hmisc latex: table column width Jul 4, 2008 Lauri Nikkinen Hmisc latex: table column width Jul 7, 2008

Law, Jason

Last active: Jul 8, 2008
1 msg
Law, Jason R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 8, 2008

Lazarus Mramba

Last active: Jul 25, 2008
2 msgs
Lazarus Mramba Error in installing packages Jul 22, 2008 Lazarus Mramba Errror in running R2.7.1 version to R2.6.2 version Jul 25, 2008

Leandro Marino

Last active: Jul 23, 2008
17 msgs
Leandro Marino RES: how to automatically maximize the graph window (under XP) ? Jul 1, 2008 Leandro Marino RES: "Invalid object" error in boxplot Jul 1, 2008 Leandro Marino RES: WIERD: Basic computing in R Jul 1, 2008 Leandro Marino plot window Jul 1, 2008 Leandro Marino RES: plot window Jul 1, 2008 Leandro Marino RES: Change name of a specific column of a data frame Jul 1, 2008 Leandro Marino RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries) Jul 2, 2008 Leandro Marino Migrating from S-Plus to R - Exporting Tables Jul 2, 2008 Leandro Marino exporting ftable Jul 2, 2008 Leandro Marino RES: initialize a matrix Jul 4, 2008 Leandro Marino RES: Error while plotting matrix Jul 4, 2008 Leandro Marino RES: Sum(Random Numbers)=100 Jul 8, 2008 Leandro Marino Bootstrap in betareg() Jul 10, 2008 Leandro Marino Exporting an list() Jul 15, 2008 Leandro Marino Colours in R Jul 17, 2008 Leandro Marino RES: Colours in R Jul 17, 2008 Leandro Marino RES: Simple... but... Jul 23, 2008

Li, Xuejun

Last active: Jul 10, 2008
1 msg
Li, Xuejun S4 class questions Jul 10, 2008

Liaw, Andy

Last active: Jul 31, 2008
4 msgs
Liaw, Andy Random Forest %var(y) Jul 15, 2008 Liaw, Andy randomForest outlier Jul 16, 2008 Liaw, Andy confusion matrix in randomForest Jul 21, 2008 Liaw, Andy equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 31, 2008

Lily

Last active: Jul 6, 2008
1 msg
Lily Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 6, 2008

Lisa Readdy

Last active: Jul 31, 2008
1 msg
Lisa Readdy nls weights warning message Jul 31, 2008

Lisa Rees

Last active: Jul 13, 2008
1 msg
Lisa Rees Moran's I- Ordinal Logistic Regression Jul 13, 2008

Lord Yo

Last active: Jul 8, 2008
1 msg
Lord Yo How to change labels in a histogram Jul 8, 2008

LostInTimeAndSpace

Last active: Jul 15, 2008
1 msg
LostInTimeAndSpace Proxy again, this time on a Mac Jul 15, 2008

Luciano La Sala

Last active: Jul 9, 2008
1 msg
Luciano La Sala Basic help needed Jul 9, 2008

Luis F

Last active: Jul 18, 2008
1 msg
Luis F only "T" becomes logical colum with read.table Jul 18, 2008

Luis Reino

Last active: Jul 29, 2008
2 msgs
Luis Reino Bootstraping GAMs: confidence intervals Jul 24, 2008 Luis Reino Bootstraping GAMs for confidence intervales calculation Jul 29, 2008

Luke Tierney

Last active: Jul 10, 2008
3 msgs
Luke Tierney passing a variable at the command line Jul 2, 2008 Luke Tierney Parallel R Jul 10, 2008 Luke Tierney compiling pnmath on an intel processor running mac OS 10.5 Jul 10, 2008

Lyman, Mark

Last active: Jul 17, 2008
3 msgs
Lyman, Mark Rmpi unkown input format error Jul 10, 2008 Lyman, Mark Problem with mpi.close.Rslaves() Jul 16, 2008 Lyman, Mark Problem with mpi.close.Rslaves() Jul 17, 2008

M Ensbey

Last active: Jul 30, 2008
1 msg
M Ensbey Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008

M Perez

Last active: Jul 21, 2008
1 msg
M Perez SVM: Graphical representation Jul 21, 2008

MAIDER MATEOS DEL PINO

Last active: Jul 29, 2008
1 msg
MAIDER MATEOS DEL PINO optim fails when using arima Jul 29, 2008

Mafalda Viana

Last active: Jul 2, 2008
1 msg
Mafalda Viana Insert text in data.frame Jul 2, 2008

Marc Fischer

Last active: Jul 27, 2008
2 msgs
Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 27, 2008 Marc Fischer equivalent R functions for Numerical Recipes fitxy and fitexy ? Jul 27, 2008

Marc Schwartz

Last active: Jul 31, 2008
66 msgs
Marc Schwartz reshape matrices Jul 1, 2008 Marc Schwartz if one of 4 conditions is not satisfied Jul 1, 2008 Marc Schwartz WIERD: Basic computing in R Jul 1, 2008 Marc Schwartz passing a variable at the command line Jul 1, 2008 Marc Schwartz Sunset in Dortmund Jul 2, 2008 Marc Schwartz Problem reading from a data frame Jul 2, 2008 Marc Schwartz Sunset in Dortmund Jul 2, 2008 Marc Schwartz Reading CSV file with unequal record length Jul 2, 2008 Marc Schwartz Accessing a field in a data fram Jul 2, 2008 Marc Schwartz Sunset in Dortmund Jul 3, 2008 Marc Schwartz Thanks! Jul 3, 2008 Marc Schwartz *** significance with xtable Jul 3, 2008 Marc Schwartz Relative Mortality Risk second part Jul 3, 2008 Marc Schwartz apply with a division Jul 3, 2008 Marc Schwartz Re ad in a file - produce independent vectors Jul 4, 2008 Marc Schwartz Bland-Altman method to measure agreement with repeated measures Jul 5, 2008 Marc Schwartz Interest in a Use R Group in San Francisco area? Jul 7, 2008 Marc Schwartz Interest in a Use R Group in San Francisco area? Jul 7, 2008 Marc Schwartz randomly select duplicated entries Jul 9, 2008 Marc Schwartz zoo and cex Jul 9, 2008 Marc Schwartz Help on Installing Matrix Package in Linux (Fedora) Jul 9, 2008 Marc Schwartz search with help.start Jul 10, 2008 Marc Schwartz More compact form of lm object that can be used for prediction? Jul 11, 2008 Marc Schwartz More compact form of lm object that can be used for prediction? Jul 11, 2008 Marc Schwartz Backslash in sub pattern? Jul 14, 2008 Marc Schwartz Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008 Marc Schwartz Hiding information about functions in newly developed packages Jul 17, 2008 Marc Schwartz REvolution computing Jul 17, 2008 Marc Schwartz size and coding error in plot ? Jul 17, 2008 Marc Schwartz Access to values of function arguments Jul 20, 2008 Marc Schwartz fill in area between 2 lines with a color Jul 20, 2008 Marc Schwartz Getting plot axes where they should be! Jul 21, 2008 Marc Schwartz How to filter a data frame? Jul 22, 2008 Marc Schwartz Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Marc Schwartz data transformation Jul 22, 2008 Marc Schwartz Convert list of lists <--> data frame Jul 23, 2008 Marc Schwartz sequential sum of a vector... Jul 23, 2008 Marc Schwartz Convert list of lists <--> data frame Jul 23, 2008 Marc Schwartz how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008 Marc Schwartz how to export ".xls" file with colorful cells? Jul 24, 2008 Marc Schwartz incrementing for loop by 2 Jul 24, 2008 Marc Schwartz How to delete duplicate cases? Jul 24, 2008 Marc Schwartz Beginning lm Jul 26, 2008 Marc Schwartz Add a Vector to a Matrix Jul 26, 2008 Marc Schwartz RODBC to query an Oracle table Jul 28, 2008 Marc Schwartz Legality Question about R's Open Source GNU GPL License Jul 28, 2008 Marc Schwartz How to unsubscribe? Jul 28, 2008 Marc Schwartz Most often pairs of chars across grouping variable Jul 29, 2008 Marc Schwartz Graphics function question Jul 29, 2008 Marc Schwartz Graphics function question Jul 29, 2008 Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Marc Schwartz R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Marc Schwartz odds ratios in multiway tables (stratified) Jul 30, 2008 Marc Schwartz setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008 Marc Schwartz Random subset Jul 30, 2008 Marc Schwartz Random subset Jul 30, 2008 Marc Schwartz History pruning Jul 30, 2008 Marc Schwartz john chambers R book Jul 30, 2008 Marc Schwartz stats question Jul 31, 2008 Marc Schwartz odds ratios in multiway tables (stratified) Jul 31, 2008 Marc Schwartz History pruning Jul 31, 2008 Marc Schwartz Random number generation Jul 31, 2008 Marc Schwartz Randomly drawing observations from factors. Jul 31, 2008 Marc Schwartz instal tar.gz package on windows Jul 31, 2008 Marc Schwartz Help with hazard plots Jul 31, 2008

Marcelo Laia

Last active: Jul 14, 2008
2 msgs
Marcelo Laia Tissue specific genes by ANOVA? Jul 14, 2008 Marcelo Laia Tissue specific genes by ANOVA? Jul 14, 2008

Marco Chiapello

Last active: Jul 17, 2008
1 msg
Marco Chiapello Graph Jul 17, 2008

Marco Salvi

Last active: Jul 1, 2008
1 msg
Marco Salvi Set default value Jul 1, 2008

Marco Scutari

Last active: Jul 3, 2008
1 msg
Marco Scutari Prediction with Bayesian Network? Jul 3, 2008

Maria Rizzo

Last active: Jul 17, 2008
1 msg
Maria Rizzo Sampling distribution (PDF & CDF) of correlation Jul 17, 2008

Mariana Carla Gambarotta

Last active: Jul 17, 2008
1 msg
Mariana Carla Gambarotta REvolution computing Jul 17, 2008

Mariana Gamb

Last active: Jul 10, 2008
1 msg
Mariana Gamb RE volution Jul 10, 2008

MarinaTarantini

Last active: Jul 31, 2008
1 msg
MarinaTarantini combinations with replications Jul 31, 2008

Mario Cools

Last active: Jul 9, 2008
1 msg
Mario Cools Question concerning Furness iteration & subprogram/modules Jul 9, 2008

Marisa Laetitia

Last active: Jul 29, 2008
1 msg
Marisa Laetitia Bug in sd() and var() in handling vectors of NA (R version 2.7.1)? Jul 29, 2008

Mark Cowley

Last active: Jul 15, 2008
1 msg
Mark Cowley negative P-values with shapiro.test Jul 15, 2008

Mark Difford

Last active: Jul 31, 2008
34 msgs
Mark Difford Can R do this ? Jul 8, 2008 Mark Difford cex.axis for the x axis Jul 9, 2008 Mark Difford cex.axis for the x axis Jul 9, 2008 Mark Difford Strptime/ date time classes Jul 9, 2008 Mark Difford Strptime/ date time classes Jul 14, 2008 Mark Difford meaning of tests presented in anova(ols(...)) {Design package} Jul 15, 2008 Mark Difford Font quality in base graphics Jul 15, 2008 Mark Difford Font quality in base graphics Jul 16, 2008 Mark Difford Font quality in base graphics Jul 16, 2008 Mark Difford help with bivariate density plot question Jul 17, 2008 Mark Difford calculate differences - strange outcome Jul 17, 2008 Mark Difford Newbie's question about lm Jul 17, 2008 Mark Difford R version 2.7.1 (warnings) Jul 19, 2008 Mark Difford R version 2.7.1 (warnings) Jul 20, 2008 Mark Difford Decoding subscripts/superscripts from CSVs Jul 22, 2008 Mark Difford Accessing individual variables from summary of lm Jul 22, 2008 Mark Difford Accessing individual variables from summary of lm Jul 22, 2008 Mark Difford Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Mark Difford Histogram Jul 23, 2008 Mark Difford Just 2 more questions - for now! Jul 24, 2008 Mark Difford factor question Jul 24, 2008 Mark Difford R-package install Jul 24, 2008 Mark Difford extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008 Mark Difford Beginning lm Jul 26, 2008 Mark Difford A easy way to write formula Jul 27, 2008 Mark Difford graphing regression coefficients and standard errors Jul 28, 2008 Mark Difford multiv Jul 28, 2008 Mark Difford Help interpreting density(). Jul 28, 2008 Mark Difford Help interpreting density(). Jul 29, 2008 Mark Difford Help interpreting density(). Jul 29, 2008 Mark Difford Re peated Measure ANOVA-Old question Jul 29, 2008 Mark Difford Re peated Measure ANOVA-Old question Jul 30, 2008 Mark Difford Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008 Mark Difford Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008

Mark Kimpel

Last active: Jul 30, 2008
3 msgs
Mark Kimpel source code for R-dev packages Jul 13, 2008 Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008 Mark Kimpel setting editor environment variable EDITOR either when configuring R for installation or in .Rprofile Jul 30, 2008

Mark Leeds

Last active: Jul 31, 2008
11 msgs
Mark Leeds is there an equivalent of prop.table but for counts Jul 1, 2008 Mark Leeds forget my previous question Jul 1, 2008 Mark Leeds lattice question Jul 5, 2008 Mark Leeds Numbers as Points in Graphs Jul 6, 2008 Mark Leeds Numbers as Points in Graphs Jul 6, 2008 Mark Leeds Can I do regression by steps? Jul 8, 2008 Mark Leeds shapiro wilk normality test Jul 12, 2008 Mark Leeds statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008 Mark Leeds spreading the risk Jul 18, 2008 Mark Leeds john chambers R book Jul 30, 2008 Mark Leeds sort rows of matrix by rows of another matrix Jul 31, 2008

Mark Lyman

Last active: Jul 1, 2008
2 msgs
Mark Lyman Simulate from a GAM model Jul 1, 2008 Mark Lyman WIERD: Basic computing in R Jul 1, 2008

Markus Mühlbacher

Last active: Jul 26, 2008
1 msg
Markus Mühlbacher Remove non-numerical columns from data frame Jul 26, 2008

Marta Colombo

Last active: Jul 13, 2008
3 msgs
Marta Colombo fisher.test Jul 8, 2008 Marta Colombo fisher.test Jul 8, 2008 Marta Colombo shapiro wilk normality test Jul 13, 2008

Martin Henry H. Stevens

Last active: Jul 30, 2008
3 msgs
Martin Henry H. Stevens {spam?} Re: Error: cannot use PQL when using lmer Jul 6, 2008 Martin Henry H. Stevens Repeated measures lme or anova Jul 6, 2008 Martin Henry H. Stevens R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008

Martin Maechler

Last active: Jul 30, 2008
15 msgs
Martin Maechler as.Date() clarification Jul 3, 2008 Martin Maechler Can't install package Matrix on solaris. Jul 3, 2008 Martin Maechler R logo Jul 16, 2008 Martin Maechler negative P-values with shapiro.test Jul 16, 2008 Martin Maechler negative P-values with shapiro.test Jul 17, 2008 Martin Maechler probleme with R CMD check Jul 18, 2008 Martin Maechler asp and ylim Jul 21, 2008 Martin Maechler drawing segments through points with pch=1 Jul 21, 2008 Martin Maechler asp and ylim Jul 21, 2008 Martin Maechler Large number of dummy variables Jul 22, 2008 Martin Maechler S4 : setGeneric for classical methods Jul 23, 2008 Martin Maechler Write lower half of distance matrix only Jul 26, 2008 Martin Maechler S4 : setGeneric for classical methods Jul 26, 2008 Martin Maechler S4 : setGeneric for classical methods Jul 28, 2008 Martin Maechler R command history -- can it be like Matlab's? Jul 30, 2008

Martin Morgan

Last active: Jul 30, 2008
11 msgs
Martin Morgan problem with mpiexec and Rmpi Jul 1, 2008 Martin Morgan list genes w/n a genomic fragment Jul 7, 2008 Martin Morgan Parallel R Jul 10, 2008 Martin Morgan S4 class questions Jul 10, 2008 Martin Morgan embarrassingly parallel problem - simple loop solution Jul 10, 2008 Martin Morgan mpirun question with Rmpi Jul 13, 2008 Martin Morgan Parallel Processing and Linear Regression Jul 25, 2008 Martin Morgan S4 class and Package NAMESPACE [NC] Jul 25, 2008 Martin Morgan how i can install Rgraphviz in R2.7.1 Jul 26, 2008 Martin Morgan read XML Jul 30, 2008 Martin Morgan read XML Jul 30, 2008

Matt

Last active: Jul 14, 2008
1 msg
Matt rgl.snapshot on linux produces colored lines only Jul 14, 2008

Matthew Keller

Last active: Jul 26, 2008
1 msg
Matthew Keller 64-bit R on Mac OS X 10.4.5 Jul 26, 2008

Matthias Bannert

Last active: Jul 3, 2008
1 msg
Matthias Bannert latex styling for R regression outputs Jul 3, 2008

Matthieu Stigler

Last active: Jul 2, 2008
2 msgs
Matthieu Stigler Which distribution best fits the data? Jul 1, 2008 Matthieu Stigler Optimal lag selection in Granger Causality tests Jul 2, 2008

Matti Pastell

Last active: Jul 12, 2008
1 msg
Matti Pastell Another failed attempt to install an R package in Ubuntu Jul 12, 2008

Max

Last active: Jul 31, 2008
4 msgs
Max Question regarding statisticians Jul 29, 2008 Max Random number generation Jul 31, 2008 Max Random number generation Jul 31, 2008 Max Random number generation Jul 31, 2008

Mayukh Dass

Last active: Jul 1, 2008
1 msg
Mayukh Dass Problem with loading library-ks Jul 1, 2008

Megan J Bellamy

Last active: Jul 28, 2008
2 msgs
Megan J Bellamy Using RODBC to use SQL queries Jul 23, 2008 Megan J Bellamy RODBC to query an Oracle table Jul 28, 2008

Megh Dal

Last active: Jul 24, 2008
8 msgs
Megh Dal Error in defining function Jul 6, 2008 Megh Dal Error in defining function Jul 6, 2008 Megh Dal Error in defining function Jul 7, 2008 Megh Dal How to extract folowing data? Jul 14, 2008 Megh Dal scatter plot using ggplot Jul 22, 2008 Megh Dal scatter plot using ggplot Jul 22, 2008 Megh Dal Interactive plot Jul 24, 2008 Megh Dal Interactive plot Jul 24, 2008

Michael

Last active: Jul 31, 2008
6 msgs
Michael R command history -- can it be like Matlab's? Jul 29, 2008 Michael R command history -- can it be like Matlab's? Jul 29, 2008 Michael What's the best way to operate R from within Excel? Jul 29, 2008 Michael What's the best way to operate R from within Excel? Jul 30, 2008 Michael R command history -- can it be like Matlab's? Jul 30, 2008 Michael clustering and data-mining... Jul 31, 2008

Michael Bibo

Last active: Jul 19, 2008
1 msg
Michael Bibo Graphics not working for R in ubuntu Jul 19, 2008

Michael Denslow

Last active: Jul 4, 2008
2 msgs
Michael Denslow by or tapply? Jul 3, 2008 Michael Denslow p-value for Nonmetric Multidimentional Scaling? Jul 4, 2008

Michael Dewey

Last active: Jul 30, 2008
1 msg
Michael Dewey ~ . help Jul 30, 2008

Michael Friendly

Last active: Jul 23, 2008
2 msgs
Michael Friendly extracting elements from print object of Manova() Jul 16, 2008 Michael Friendly Convert list of lists <--> data frame Jul 23, 2008

Michael Frumin

Last active: Jul 31, 2008
1 msg
Michael Frumin bug in 'margins' behavior in reshape - cast Jul 31, 2008

Michael Hopkins

Last active: Jul 2, 2008
2 msgs
Michael Hopkins dev.off() inside a function & other glitches Jul 1, 2008 Michael Hopkins dev.off() inside a function & other glitches Jul 2, 2008

Michael Kubovy

Last active: Jul 23, 2008
3 msgs
Michael Kubovy playwith package crashes on Mac Jul 15, 2008 Michael Kubovy Output design question Jul 16, 2008 Michael Kubovy an extremely simple question Jul 23, 2008

Michael Lawrence

Last active: Jul 24, 2008
14 msgs
Michael Lawrence odd dnorm behaviour (?) Jul 7, 2008 Michael Lawrence odd dnorm behaviour (?) Jul 7, 2008 Michael Lawrence Lattice: merged strips? Jul 9, 2008 Michael Lawrence Interpolation of data Jul 10, 2008 Michael Lawrence Lattice: merged strips? Jul 10, 2008 Michael Lawrence compiling pnmath on an intel processor running mac OS 10.5 Jul 10, 2008 Michael Lawrence Lattice: merged strips? Jul 11, 2008 Michael Lawrence Quick plotmath question Jul 12, 2008 Michael Lawrence Quick plotmath question Jul 13, 2008 Michael Lawrence aov error with large data set Jul 15, 2008 Michael Lawrence playwith package crashes on Mac Jul 15, 2008 Michael Lawrence Sampling distribution (PDF & CDF) of correlation Jul 17, 2008 Michael Lawrence help with data layout Jul 17, 2008 Michael Lawrence error with .dll file and RGtk2 Jul 24, 2008

Michael Rennie

Last active: Jul 15, 2008
11 msgs
Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 6, 2008 Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 6, 2008 Michael Rennie sorting a data frame by rownames Jul 8, 2008 Michael Rennie matplot help Jul 10, 2008 Michael Rennie Issue with postscript figures using WinAnsi encoding Jul 10, 2008 Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008 Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008 Michael Rennie extracting elements from print object of Manova() Jul 15, 2008 Michael Rennie manipulating (extracting) data from distance matrices Jul 15, 2008 Michael Rennie Iterations Jul 15, 2008 Michael Rennie Iterations Jul 15, 2008

Michal Figurski

Last active: Jul 31, 2008
14 msgs
Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Michal Figurski [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 23, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 23, 2008 Michal Figurski [Fwd: Re: Coefficients of Logistic Regression from bootstrap - how to get them?] Jul 24, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 24, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 30, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008 Michal Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 31, 2008

Michal J. Figurski

Last active: Jul 22, 2008
1 msg
Michal J. Figurski Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008

Michela Cameletti

Last active: Jul 21, 2008
3 msgs
Michela Cameletti Set default value Jul 1, 2008 Michela Cameletti avoid loop with three-dimensional array Jul 21, 2008 Michela Cameletti Avoid loop with three-dimensional array Jul 21, 2008

Michele Santacatterina

Last active: Jul 2, 2008
1 msg
Michele Santacatterina error on predict Jul 2, 2008

Miha Staut

Last active: Jul 9, 2008
2 msgs
Miha Staut Help with installing add-on packages Jul 9, 2008 Miha Staut Help with installing add-on packages Jul 9, 2008

Mike Lawrence

Last active: Jul 20, 2008
2 msgs
Mike Lawrence Lattice: merged strips? Jul 9, 2008 Mike Lawrence Off topic: SS formulae for 3-way repeated measure anova (for when aov() fails) Jul 20, 2008

Mike Prager

Last active: Jul 29, 2008
5 msgs
Mike Prager Font quality in base graphics Jul 15, 2008 Mike Prager Change font-face in title Jul 22, 2008 Mike Prager drawing segments through points with pch=1 Jul 22, 2008 Mike Prager Change font-face in title Jul 23, 2008 Mike Prager try question Jul 29, 2008

Mikhail Spivakov

Last active: Jul 17, 2008
1 msg
Mikhail Spivakov fastICA Jul 17, 2008

Miklos Kiss

Last active: Jul 19, 2008
2 msgs
Miklos Kiss Another failed attempt to install an R package in Ubuntu Jul 11, 2008 Miklos Kiss confusion matrix in randomForest Jul 19, 2008

Mitchell Maltenfort

Last active: Jul 23, 2008
1 msg
Mitchell Maltenfort Simple... but... Jul 23, 2008

Moira Burke

Last active: Jul 17, 2008
2 msgs
Moira Burke Function to create variables with prefix Jul 14, 2008 Moira Burke Function to create variables with prefix Jul 17, 2008

Momin, Amin A

Last active: Jul 25, 2008
2 msgs
Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 Jul 24, 2008 Momin, Amin A Installation error for RCurl in Redhat enterrpise 5 Jul 25, 2008

Monica Pisica

Last active: Jul 23, 2008
7 msgs
Monica Pisica PCA on image data Jul 3, 2008 Monica Pisica Comparing differences in AUC from 2 different models Jul 17, 2008 Monica Pisica saving plot both as jpg and pdf Jul 22, 2008 Monica Pisica saving plot both as jpg and pdf Jul 22, 2008 Monica Pisica Warning message in if else statement Jul 23, 2008 Monica Pisica Warning message in if else statement Jul 23, 2008 Monica Pisica Warning message in if else statement Jul 23, 2008

Mose Andre

Last active: Jul 19, 2008
1 msg
Mose Andre Graphics not working for R in ubuntu Jul 19, 2008

Moshe Olshansky

Last active: Jul 31, 2008
25 msgs
Moshe Olshansky A regression problem using dummy variables Jul 1, 2008 Moshe Olshansky Lots of huge matrices, for-loops, speed Jul 6, 2008 Moshe Olshansky Lots of huge matrices, for-loops, speed Jul 6, 2008 Moshe Olshansky Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008 Moshe Olshansky multiplication question Jul 7, 2008 Moshe Olshansky odd dnorm behaviour (?) Jul 7, 2008 Moshe Olshansky Sum(Random Numbers)=100 Jul 7, 2008 Moshe Olshansky Sum(Random Numbers)=100 Jul 8, 2008 Moshe Olshansky rounding Jul 10, 2008 Moshe Olshansky rounding Jul 10, 2008 Moshe Olshansky number of effective tests Jul 10, 2008 Moshe Olshansky spectral decomposition for near-singular pd matrices Jul 16, 2008 Moshe Olshansky spectral decomposition for near-singular pd matrices Jul 16, 2008 Moshe Olshansky Constrained coefficients in lm (correction) Jul 23, 2008 Moshe Olshansky simple random number generation Jul 24, 2008 Moshe Olshansky product of successive rows Jul 29, 2008 Moshe Olshansky finding a faster way to do an iterative computation Jul 29, 2008 Moshe Olshansky Chi-square parameter estimation Jul 29, 2008 Moshe Olshansky Urgent Jul 29, 2008 Moshe Olshansky Sampling two exponentials Jul 30, 2008 Moshe Olshansky stats question Jul 31, 2008 Moshe Olshansky Code to calculate internal rate of return Jul 31, 2008 Moshe Olshansky cutting out numbers from vectors Jul 31, 2008 Moshe Olshansky Grouping Index of Matrix Based on Certain Condition Jul 31, 2008 Moshe Olshansky cutting out numbers from vectors Jul 31, 2008

Murali K

Last active: Jul 25, 2008
2 msgs
Murali K matrix multiplication question Jul 17, 2008 Murali K graphing regression coefficients and standard errors Jul 25, 2008

Murali Menon

Last active: Jul 3, 2008
2 msgs
Murali Menon multiplication question Jul 2, 2008 Murali Menon multiplication question Jul 3, 2008

N. Lapidus

Last active: Jul 23, 2008
3 msgs
N. Lapidus multiplication question Jul 2, 2008 N. Lapidus Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 N. Lapidus Convert list of lists <--> data frame Jul 23, 2008

Nadeem Shafique

Last active: Jul 3, 2008
1 msg
Nadeem Shafique Problem in applying conditional looping Jul 3, 2008

Naiara Pinto

Last active: Jul 4, 2008
1 msg
Naiara Pinto synthax for R CMD INSTALL Jul 4, 2008

Nair, Murlidharan T

Last active: Jul 2, 2008
2 msgs
Nair, Murlidharan T heatmap Jul 2, 2008 Nair, Murlidharan T heatmap Jul 2, 2008

Natalia Quinteros

Last active: Jul 25, 2008
1 msg
Natalia Quinteros Building a data frame with missing data Jul 25, 2008

Nataraj

Last active: Jul 18, 2008
1 msg
Nataraj Graphics not working for R in ubuntu Jul 18, 2008

Neil Gupta

Last active: Jul 11, 2008
1 msg
Neil Gupta plotting granular data Jul 11, 2008

Nelson Villoria

Last active: Jul 25, 2008
1 msg
Nelson Villoria Matrix from List Jul 25, 2008

Neumann, Steffen

Last active: Jul 3, 2008
2 msgs
Neumann, Steffen Removing or overwriting an XML node Jul 2, 2008 Neumann, Steffen Removing or overwriting an XML subtree Jul 3, 2008

Nicole Krämer

Last active: Jul 10, 2008
1 msg
Nicole Krämer ppls: version 1.02 including a new data set Jul 10, 2008

Nora Hanson

Last active: Jul 21, 2008
2 msgs
Nora Hanson Cross correlation significance test Jul 21, 2008 Nora Hanson Cross correlation significance test Jul 21, 2008

Nordlund, Dan (DSHS/RDA)

Last active: Jul 24, 2008
7 msgs
Nordlund, Dan (DSHS/RDA) Iterations Jul 15, 2008 Nordlund, Dan (DSHS/RDA) Row Sum, exclude positive values Jul 15, 2008 Nordlund, Dan (DSHS/RDA) how to speed up this for loop? Jul 22, 2008 Nordlund, Dan (DSHS/RDA) how to speed up this for loop? Jul 22, 2008 Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Nordlund, Dan (DSHS/RDA) NAs - NAs are not allowed in subscripted assignments Jul 24, 2008

Nutter, Benjamin

Last active: Jul 28, 2008
4 msgs
Nutter, Benjamin Bland-Altman method to measure agreement with repeated measures Jul 7, 2008 Nutter, Benjamin Simple... but... Jul 23, 2008 Nutter, Benjamin Matrix barplot Jul 25, 2008 Nutter, Benjamin Color of box frame in Legend (Was: Matrix barplot) Jul 28, 2008

ONKELINX, Thierry

Last active: Jul 31, 2008
21 msgs
ONKELINX, Thierry Regression and fitting Jul 1, 2008 ONKELINX, Thierry trivial list question Jul 1, 2008 ONKELINX, Thierry Optimal lag selection in Granger Causality tests Jul 2, 2008 ONKELINX, Thierry Correlation structures in gls with repeated measurements Jul 2, 2008 ONKELINX, Thierry RODBC Access limit? Jul 3, 2008 ONKELINX, Thierry Matrix set value problem Jul 3, 2008 ONKELINX, Thierry How can I optimize this piece of code ? Jul 7, 2008 ONKELINX, Thierry A quick question about lm() Jul 7, 2008 ONKELINX, Thierry Histogram with colors according to factor Jul 8, 2008 ONKELINX, Thierry Histogram with colors according to factor Jul 8, 2008 ONKELINX, Thierry "Spreading risk" in a matrix Jul 18, 2008 ONKELINX, Thierry "Spreading risk" in a matrix Jul 19, 2008 ONKELINX, Thierry scatter plot using ggplot Jul 23, 2008 ONKELINX, Thierry experimental semivariogram Jul 23, 2008 ONKELINX, Thierry Indicator Kriging? Jul 23, 2008 ONKELINX, Thierry Simple... but... Jul 23, 2008 ONKELINX, Thierry A easy way to write formula Jul 27, 2008 ONKELINX, Thierry Retain plot? Jul 27, 2008 ONKELINX, Thierry speeding up loop and dealing wtih memory problems Jul 28, 2008 ONKELINX, Thierry 'for' loop, two variables Jul 29, 2008 ONKELINX, Thierry combinations with replications Jul 31, 2008

Oehler, Friderike (AGPP)

Last active: Jul 29, 2008
3 msgs
Oehler, Friderike (AGPP) rm(l*) Jul 14, 2008 Oehler, Friderike (AGPP) aggregate months to years Jul 14, 2008 Oehler, Friderike (AGPP) 'for' loop, two variables Jul 29, 2008

Oliver M. Haynold

Last active: Jul 27, 2008
2 msgs
Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 26, 2008 Oliver M. Haynold Lattice wireframe: How to avoid drawing lines around polygons when using shade=TRUE Jul 27, 2008

Owen Jones

Last active: Jul 28, 2008
1 msg
Owen Jones Fill in NA values in vector with previous character/factor Jul 28, 2008

PIKAL Petr

Last active: Jul 24, 2008
15 msgs
PIKAL Petr Odp: newbie needs help plotting time series Jul 1, 2008 PIKAL Petr bug in axis.Date? was (Re: newbie needs help plotting time series) Jul 2, 2008 PIKAL Petr Odp: RES: bug in axis.Date? was (Re: newbie needs help plotting timeseries) Jul 2, 2008 PIKAL Petr Odp: FW: RES: bug in axis.Date? was (Re: newbie needs help plottingtimeseries) Jul 2, 2008 PIKAL Petr Odp: set values in data.frame to NA conditional on another data.frame Jul 3, 2008 PIKAL Petr problem with lm and predict - no predictions made Jul 3, 2008 PIKAL Petr Odp: Re ad in a file - produce independent vectors Jul 4, 2008 PIKAL Petr Thanks! Jul 10, 2008 PIKAL Petr Odp: specifying data Jul 10, 2008 PIKAL Petr Odp: aggregate months to years Jul 14, 2008 PIKAL Petr Odp: calculate differences - strange outcome Jul 17, 2008 PIKAL Petr Odp: Colours in R Jul 17, 2008 PIKAL Petr Odp: Graph Jul 17, 2008 PIKAL Petr Odp: how to speed up this for loop? Jul 22, 2008 PIKAL Petr Odp: sum each row and output results Jul 24, 2008

Paek, Insu

Last active: Jul 4, 2008
1 msg
Paek, Insu Calling and running a compiled program inside R Jul 4, 2008

Pancrazio Bertaccini

Last active: Jul 9, 2008
1 msg
Pancrazio Bertaccini plot gam "main effect functions" in one graph Jul 9, 2008

Paolo Sonego

Last active: Jul 10, 2008
4 msgs
Paolo Sonego Parsing Jul 9, 2008 Paolo Sonego Parsing Jul 9, 2008 Paolo Sonego Parsing Jul 9, 2008 Paolo Sonego Parsing Jul 10, 2008

Param Priya Singh

Last active: Jul 15, 2008
1 msg
Param Priya Singh linear and non linear regression in 3D ! Jul 15, 2008

Partha

Last active: Jul 1, 2008
1 msg
Partha Help on Analysis of covariance Jul 1, 2008

Patil, Prasad

Last active: Jul 31, 2008
1 msg
Patil, Prasad 'system' command through Rserve Jul 31, 2008

Patrick Aboyoun

Last active: Jul 15, 2008
1 msg
Patrick Aboyoun counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008

Patrick Burns

Last active: Jul 28, 2008
15 msgs
Patrick Burns Sum(Random Numbers)=100 Jul 8, 2008 Patrick Burns about EM algorithm Jul 8, 2008 Patrick Burns Subsetting an array by a vector of dimensions Jul 11, 2008 Patrick Burns Supressing printing from a function: ecdf Jul 15, 2008 Patrick Burns Regression problem Jul 15, 2008 Patrick Burns column wise paste of data.frames Jul 18, 2008 Patrick Burns function "eigen" AND Minitab Jul 18, 2008 Patrick Burns initialize a factor vector Jul 19, 2008 Patrick Burns initialize a factor vector Jul 19, 2008 Patrick Burns Using if, else statements Jul 23, 2008 Patrick Burns convert a vector of words into a matrix Jul 24, 2008 Patrick Burns Dividing by 0 Jul 25, 2008 Patrick Burns Help with a loop Jul 28, 2008 Patrick Burns Legality Question about R's Open Source GNU GPL License Jul 28, 2008 Patrick Burns Case statements in R Jul 28, 2008

Patrick Connolly

Last active: Jul 21, 2008
2 msgs
Patrick Connolly Installing R into home directory? Jul 3, 2008 Patrick Connolly Howto Restart A Function with Try-Error Catch Jul 21, 2008

Patrick Jackson

Last active: Jul 3, 2008
3 msgs
Patrick Jackson log plots woes Jul 2, 2008 Patrick Jackson graph woes Jul 2, 2008 Patrick Jackson graph woes Jul 3, 2008

Patrick Richardson

Last active: Jul 17, 2008
1 msg
Patrick Richardson keeping seperate row.names Jul 17, 2008

Patrizio Frederic

Last active: Jul 31, 2008
13 msgs
Patrizio Frederic mle2(): logarithm of negative pdfs Jul 23, 2008 Patrizio Frederic How to simulate heteroscedasticity (correlation) Jul 23, 2008 Patrizio Frederic maximum likelihood method to fit a model Jul 23, 2008 Patrizio Frederic Convert list of lists <--> data frame Jul 23, 2008 Patrizio Frederic sequential sum of a vector... Jul 23, 2008 Patrizio Frederic How to delete duplicate cases? Jul 24, 2008 Patrizio Frederic product of successive rows Jul 28, 2008 Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Jul 29, 2008 Patrizio Frederic table questions Jul 29, 2008 Patrizio Frederic What's the best way to operate R from within Excel? Jul 30, 2008 Patrizio Frederic Howto Draw Bimodal Gamma Curve with User Supplied Parameters Jul 30, 2008 Patrizio Frederic tensor product of equi-spaced B-splines in the unit square Jul 31, 2008 Patrizio Frederic Random number generation Jul 31, 2008

Paul Adams

Last active: Jul 29, 2008
6 msgs
Paul Adams Plot Jul 8, 2008 Paul Adams (no subject) Jul 13, 2008 Paul Adams error in test Jul 25, 2008 Paul Adams list Jul 28, 2008 Paul Adams max Jul 29, 2008 Paul Adams accessing list elements Jul 29, 2008

Paul Emberson

Last active: Jul 30, 2008
3 msgs
Paul Emberson function to transform response of a formula Jul 30, 2008 Paul Emberson function to transform response of a formula Jul 30, 2008 Paul Emberson function to transform response of a formula Jul 30, 2008

Paul Gilbert

Last active: Jul 7, 2008
1 msg
Paul Gilbert Exception Handling Jul 7, 2008

Paul Hiemstra

Last active: Jul 26, 2008
9 msgs
Paul Hiemstra Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008 Paul Hiemstra Are centre coordinates or upper left corners used of x, y for SpatialPixels? Jul 1, 2008 Paul Hiemstra latex styling for R regression outputs Jul 3, 2008 Paul Hiemstra kriging problem(?) Jul 4, 2008 Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008 Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008 Paul Hiemstra How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008 Paul Hiemstra Howto view function's source code of an installed package Jul 16, 2008 Paul Hiemstra Spatial Sample Jul 26, 2008

Paul Murrell

Last active: Jul 20, 2008
3 msgs
Paul Murrell Backgrounds in Multiple Plots made with "fig" Jul 6, 2008 Paul Murrell childNames for xaxis grob (grid package) Jul 9, 2008 Paul Murrell TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 20, 2008

Paul Roebuck

Last active: Jul 31, 2008
1 msg
Paul Roebuck cutting out numbers from vectors Jul 31, 2008

Paul Smith

Last active: Jul 22, 2008
5 msgs
Paul Smith Can R do this ? Jul 8, 2008 Paul Smith Constrained optimization Jul 8, 2008 Paul Smith drawing segments through points with pch=1 Jul 20, 2008 Paul Smith asp and ylim Jul 20, 2008 Paul Smith Accessing individual variables from summary of lm Jul 22, 2008

Paul.Rustomji at csiro.au

Last active: Jul 30, 2008
4 msgs
Paul.Rustomji at csiro.au How to set directory Rscript runs in/Sweave output directory Jul 27, 2008 Paul.Rustomji at csiro.au Is there a way to avoid loading dependendent packages? Jul 28, 2008 Paul.Rustomji at csiro.au Is there a better way to check if an element of a list exists than using match on names? Jul 29, 2008 Paul.Rustomji at csiro.au Is conditional evaluation of R code chunks possible in Sweave ? Jul 30, 2008

Paulo Barata

Last active: Jul 21, 2008
3 msgs
Paulo Barata Problem reading a CSV Jul 1, 2008 Paulo Barata coin package (conditional inference / permutation): parameter teststat Jul 20, 2008 Paulo Barata drawing segments through points with pch=1 Jul 21, 2008

Paulo Cardoso

Last active: Jul 30, 2008
5 msgs
Paulo Cardoso spatial statistics and matrix algebra Jul 7, 2008 Paulo Cardoso Using stop ( ) from a Text Editor Jul 28, 2008 Paulo Cardoso Using stop ( ) from a Text Editor Jul 28, 2008 Paulo Cardoso read XML Jul 30, 2008 Paulo Cardoso read XML Jul 30, 2008

Paulo Cortez

Last active: Jul 28, 2008
1 msg
Paulo Cortez RStem with portuguese language Jul 28, 2008

Pavel77

Last active: Jul 8, 2008
1 msg
Pavel77 cex.axis for the x axis Jul 8, 2008

Pedro de Barros

Last active: Jul 6, 2008
2 msgs
Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008 Pedro de Barros "lwd" gives different plotted line widths for Vertical and horizontal Lines when lwd= 2? Jul 6, 2008

Peng Jiang

Last active: Jul 8, 2008
9 msgs
Peng Jiang Mclust ??? Jun 30, 2008 Peng Jiang if one of 4 conditions is not satisfied Jul 1, 2008 Peng Jiang what can we do when R gives no response Jul 2, 2008 Peng Jiang what can we do when R gives no response Jul 2, 2008 Peng Jiang help about random generation of a Normal distribution of several variables Jul 5, 2008 Peng Jiang help about random generation of a Normal distribution of several variables Jul 5, 2008 Peng Jiang Sum(Random Numbers)=100 Jul 7, 2008 Peng Jiang what does this warning mean ? Jul 8, 2008 Peng Jiang about EM algorithm Jul 8, 2008

Peter Alspach

Last active: Jul 22, 2008
4 msgs
Peter Alspach lm and NA Jun 30, 2008 Peter Alspach multiplication question Jul 2, 2008 Peter Alspach Matching Up Values Jul 17, 2008 Peter Alspach Can't Load Text Files Jul 22, 2008

Peter Dalgaard

Last active: Jul 31, 2008
42 msgs
Peter Dalgaard extracting elements from a list in vectorized form Jul 1, 2008 Peter Dalgaard Reading CSV file with unequal record length Jul 2, 2008 Peter Dalgaard A regression problem using dummy variables Jul 3, 2008 Peter Dalgaard as.Date() clarification Jul 3, 2008 Peter Dalgaard read.table, NA assignment, and sep Jul 3, 2008 Peter Dalgaard Recoding a variable Jul 3, 2008 Peter Dalgaard Exporting a Graph that has lines() Jul 3, 2008 Peter Dalgaard lines() warning message Jul 3, 2008 Peter Dalgaard lines() warning message Jul 3, 2008 Peter Dalgaard Exporting a Graph that has lines() Jul 4, 2008 Peter Dalgaard Sorting a list Jul 7, 2008 Peter Dalgaard A shorter version of ".Last.value"? Jul 7, 2008 Peter Dalgaard A shorter version of ".Last.value"? Jul 7, 2008 Peter Dalgaard Interest in a Use R Group in San Francisco area? Jul 7, 2008 Peter Dalgaard subset() multiple arguments Jul 7, 2008 Peter Dalgaard Interest in a Use R Group in San Francisco area? Jul 7, 2008 Peter Dalgaard Sum(Random Numbers)=100 Jul 8, 2008 Peter Dalgaard nls and "plinear" algorithm Jul 8, 2008 Peter Dalgaard Change in behaviour of sd() Jul 8, 2008 Peter Dalgaard “Check” problem Jul 10, 2008 Peter Dalgaard Operator overloading Jul 10, 2008 Peter Dalgaard Operator overloading Jul 10, 2008 Peter Dalgaard What's the T-Value in fisher.test Jul 10, 2008 Peter Dalgaard Off topic: Tcl/Tk outside R. Jul 14, 2008 Peter Dalgaard statistics question about a statement in julian faraway's "extending the linear model with R" text Jul 14, 2008 Peter Dalgaard aov error with large data set Jul 16, 2008 Peter Dalgaard enscript states file for R scripts? Jul 17, 2008 Peter Dalgaard Hiding information about functions in newly developed packages Jul 17, 2008 Peter Dalgaard Reading SPSS .por files Jul 18, 2008 Peter Dalgaard Sweave add code \201 Jul 19, 2008 Peter Dalgaard replicate matrix blocks different numbers of times into new matrix Jul 19, 2008 Peter Dalgaard enumerate subsets Jul 20, 2008 Peter Dalgaard How to filter a data frame? Jul 22, 2008 Peter Dalgaard help with simulate AR(1) data Jul 22, 2008 Peter Dalgaard F test Jul 22, 2008 Peter Dalgaard F test Jul 23, 2008 Peter Dalgaard maximum likelihood method to fit a model Jul 23, 2008 Peter Dalgaard par() function does not work Jul 23, 2008 Peter Dalgaard how can I write code to detect whether the machine is Windows or Linux? Jul 24, 2008 Peter Dalgaard Help with rep Jul 25, 2008 Peter Dalgaard Remove non-numerical columns from data frame Jul 26, 2008 Peter Dalgaard reference in article Jul 31, 2008

Peter Flom

Last active: Jul 29, 2008
2 msgs
Peter Flom Question about GCL function Jul 2, 2008 Peter Flom Graphics function question Jul 29, 2008

Phil Smith

Last active: Jul 23, 2008
7 msgs
Phil Smith how do I read only specific columns using read.csv or other read function Jul 2, 2008 Phil Smith How do I paste double quotes arround a character string? Jul 2, 2008 Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008 Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008 Phil Smith correction to small typo: How do I paste double quotes arround a character string? Jul 3, 2008 Phil Smith How do I paste double quotes arround a character string? Jul 3, 2008 Phil Smith how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008

Philip Twumasi-Ankrah

Last active: Jul 1, 2008
1 msg
Philip Twumasi-Ankrah Change name of a specific column of a data frame Jul 1, 2008

Philipp Pagel

Last active: Jul 30, 2008
6 msgs
Philipp Pagel How to change labels in a histogram Jul 8, 2008 Philipp Pagel Read.table - Less rows than original data Jul 9, 2008 Philipp Pagel Cairo graphics Jul 24, 2008 Philipp Pagel problem with read.table() Jul 30, 2008 Philipp Pagel Bizarre - R crashes on merge Jul 30, 2008 Philipp Pagel Bizarre - R crashes on merge Jul 30, 2008

Philippe GROSJEAN

Last active: Jul 7, 2008
2 msgs
Philippe GROSJEAN SciViews GUI Jul 5, 2008 Philippe GROSJEAN Change language in Rcmdr Jul 7, 2008

Phillip R. Hunt

Last active: Jul 28, 2008
1 msg
Phillip R. Hunt Overlay of simple plots Jul 28, 2008

Prasenjit Kapat

Last active: Jul 16, 2008
2 msgs
Prasenjit Kapat spectral decomposition for near-singular pd matrices Jul 16, 2008 Prasenjit Kapat spectral decomposition for near-singular pd matrices Jul 16, 2008

Ptit_Bleu

Last active: Jul 17, 2008
5 msgs
Ptit_Bleu how to automatically maximize the graph window (under XP) ? Jul 1, 2008 Ptit_Bleu how to automatically maximize the graph window (under XP) ? Jul 3, 2008 Ptit_Bleu Start preferred RGui Jul 11, 2008 Ptit_Bleu Start preferred RGui Jul 11, 2008 Ptit_Bleu Newbie's question about lm Jul 17, 2008

Qian R

Last active: Jul 9, 2008
1 msg
Qian R use variable value as vector name Jul 9, 2008

R P Herrold

Last active: Jul 14, 2008
1 msg
R P Herrold Off topic: Tcl/Tk outside R. Jul 14, 2008

R_Learner

Last active: Jul 30, 2008
9 msgs
R_Learner Accessing a field in a data fram Jul 2, 2008 R_Learner Thanks! Jul 3, 2008 R_Learner Thanks! Jul 3, 2008 R_Learner Exporting a Graph that has lines() Jul 3, 2008 R_Learner Exporting a Graph that has lines() Jul 3, 2008 R_Learner Find the closest value in a list or matrix Jul 9, 2008 R_Learner Thanks! Jul 9, 2008 R_Learner Plotting Multiple lines on one plot Jul 22, 2008 R_Learner Variable name in a String Jul 30, 2008

Rainer M Krug

Last active: Jul 10, 2008
2 msgs
Rainer M Krug version problems of rkward in ubuntu hardy repository Jul 9, 2008 Rainer M Krug version problems of rkward in ubuntu hardy repository Jul 10, 2008

Rajasekaramya

Last active: Jul 29, 2008
10 msgs
Rajasekaramya help on list comparison Jul 2, 2008 Rajasekaramya lapply Jul 9, 2008 Rajasekaramya List help Jul 11, 2008 Rajasekaramya List help Jul 11, 2008 Rajasekaramya cbind help Jul 18, 2008 Rajasekaramya vector help Jul 21, 2008 Rajasekaramya writing the plots Jul 28, 2008 Rajasekaramya subscript out of bounds error. Jul 29, 2008 Rajasekaramya subscript out of bounds help Jul 29, 2008 Rajasekaramya List names help Jul 29, 2008

Ralf Tautenhahn

Last active: Jul 14, 2008
1 msg
Ralf Tautenhahn .Last() and namespace Jul 14, 2008

Ralph S.

Last active: Jul 22, 2008
8 msgs
Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008 Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008 Ralph S. replicate matrix blocks different numbers of times into new matrix Jul 19, 2008 Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 Ralph S. Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 Ralph S. Cannot re-start R after bus error Jul 22, 2008 Ralph S. Cannot re-start R after bus error Jul 22, 2008

Ranjan Bagchi

Last active: Jul 30, 2008
3 msgs
Ranjan Bagchi System exit codes Jul 30, 2008 Ranjan Bagchi System exit codes Jul 30, 2008 Ranjan Bagchi System exit codes Jul 30, 2008

Ranney, Steven

Last active: Jul 3, 2008
3 msgs
Ranney, Steven lm() question Jul 2, 2008 Ranney, Steven lines() warning message Jul 3, 2008 Ranney, Steven lines() warning message Jul 3, 2008

Raphael Saldanha

Last active: Jul 26, 2008
3 msgs
Raphael Saldanha Sample Jul 26, 2008 Raphael Saldanha Sample Jul 26, 2008 Raphael Saldanha Spatial Sample Jul 26, 2008

Rashid Nassar

Last active: Jul 8, 2008
1 msg
Rashid Nassar Question: Beginner stuck in a R cycle Jul 8, 2008

Ravi Varadhan

Last active: Jul 21, 2008
1 msg
Ravi Varadhan How to solve systems of nonlinear equations in R? Jul 21, 2008

Ray Brownrigg

Last active: Jul 15, 2008
5 msgs
Ray Brownrigg flow map lines between point pairs (latitude/longitude) Jul 2, 2008 Ray Brownrigg Lots of huge matrices, for-loops, speed Jul 6, 2008 Ray Brownrigg shading an area in a edf Jul 8, 2008 Ray Brownrigg New Zealand Maps Jul 15, 2008 Ray Brownrigg New Zealand Maps Jul 15, 2008

Rees, Lisa Marie (MU-Student)

Last active: Jul 13, 2008
1 msg
Rees, Lisa Marie (MU-Student) Moran's I test- Ordinal Logistic Regression Model Jul 13, 2008

René Capell

Last active: Jul 24, 2008
3 msgs
René Capell recursively divide a value to get a sequence Jul 9, 2008 René Capell Layers in graphs Jul 15, 2008 René Capell Is there an equivalent * operator? Jul 24, 2008

René Pineda

Last active: Jul 1, 2008
1 msg
René Pineda adtest for weibull distribution Jul 1, 2008

Rheannon

Last active: Jul 23, 2008
7 msgs
Rheannon rollmean() Jul 9, 2008 Rheannon While loop Jul 11, 2008 Rheannon long data frame selection error Jul 14, 2008 Rheannon Row Sum, exclude positive values Jul 15, 2008 Rheannon how to speed up this for loop? Jul 21, 2008 Rheannon how to speed up this for loop? Jul 22, 2008 Rheannon sum each row and output results Jul 23, 2008

Richard Cotton

Last active: Jul 31, 2008
7 msgs
Richard Cotton sequential sum of a vector... Jul 23, 2008 Richard Cotton NAs - NAs are not allowed in subscripted assignments Jul 24, 2008 Richard Cotton Fit a 3-Dimensional Line to Data Points Jul 25, 2008 Richard Cotton Panel of pie charts Jul 29, 2008 Richard Cotton try question Jul 29, 2008 Richard Cotton Need help Jul 30, 2008 Richard Cotton Identifying common prefixes from a vector of words, and delete those prefixes Jul 31, 2008

Richard M. Heiberger

Last active: Jul 14, 2008
1 msg
Richard M. Heiberger A question about using function plot Jul 14, 2008

Richard Pearson

Last active: Jul 23, 2008
8 msgs
Richard Pearson variable as part of file name Jul 2, 2008 Richard Pearson Sum(Random Numbers)=100 Jul 8, 2008 Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008 Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008 Richard Pearson Subsetting an array by a vector of dimensions Jul 11, 2008 Richard Pearson Creation of png=problems Jul 21, 2008 Richard Pearson Error in installing packages Jul 22, 2008 Richard Pearson rpart confidence intervals? Jul 23, 2008

Richard and Barbara Males

Last active: Jul 25, 2008
3 msgs
Richard and Barbara Males flow map lines between point pairs (latitude/longitude) Jul 2, 2008 Richard and Barbara Males flow map lines between point pairs (latitude/longitude) Jul 2, 2008 Richard and Barbara Males fit.dist gnlm question, NaN and Inf results Jul 25, 2008

RichardP

Last active: Jul 22, 2008
2 msgs
RichardP Plotting Multiple lines on one plot Jul 22, 2008 RichardP rpart confidence intervals? Jul 22, 2008

Riley, Steve

Last active: Jul 15, 2008
1 msg
Riley, Steve counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008

Ritwik Sinha

Last active: Jul 27, 2008
2 msgs
Ritwik Sinha graphing regression coefficients and standard errors Jul 27, 2008 Ritwik Sinha Maximization under constraits Jul 27, 2008

Rob Goedman

Last active: Jul 25, 2008
2 msgs
Rob Goedman TextMate and R Jul 22, 2008 Rob Goedman Integrating R and Textmate Jul 25, 2008

Robert

Last active: Jul 17, 2008
3 msgs
Robert float and double precision with C code Jul 17, 2008 Robert Re : float and double precision with C code Jul 17, 2008 Robert Re : Re : float and double precision with C code Jul 17, 2008

Robert A LaBudde

Last active: Jul 12, 2008
2 msgs
Robert A LaBudde shapiro wilk normality test Jul 12, 2008 Robert A LaBudde shapiro wilk normality test Jul 12, 2008

Robert Baer

Last active: Jul 24, 2008
2 msgs
Robert Baer A question about using function plot Jul 14, 2008 Robert Baer Dividing by 0 Jul 24, 2008

Robert Gentleman

Last active: Jul 25, 2008
1 msg
Robert Gentleman Plink bed files Jul 25, 2008

Robert Terwilliger

Last active: Jul 14, 2008
1 msg
Robert Terwilliger r^2 for SSasymp? Jul 14, 2008

Roberts, Kyle

Last active: Jul 21, 2008
1 msg
Roberts, Kyle lattice with bwplot Jul 21, 2008

Robin Williams

Last active: Jul 23, 2008
1 msg
Robin Williams Using if, else statements Jul 23, 2008

Rodrigo Santamaria

Last active: Jul 9, 2008
1 msg
Rodrigo Santamaria RJDBC and OracleDriver: unable to connect Jul 9, 2008

Roger Bivand

Last active: Jul 31, 2008
2 msgs
Roger Bivand Spatial Sample Jul 27, 2008 Roger Bivand question about krige code in R Jul 31, 2008

Roger Koenker

Last active: Jul 10, 2008
5 msgs
Roger Koenker Reproducibility and GUIs Jul 3, 2008 Roger Koenker L1 nonlinear approximation Jul 3, 2008 Roger Koenker Port package Jul 9, 2008 Roger Koenker Port package Jul 9, 2008 Roger Koenker quantile regression estimation results Jul 10, 2008

Roger Leenders

Last active: Jul 20, 2008
1 msg
Roger Leenders R interprets symbol as q() Jul 20, 2008

Roland Rau

Last active: Jul 30, 2008
12 msgs
Roland Rau First attempt to use R Jul 3, 2008 Roland Rau smooth.spline Jul 18, 2008 Roland Rau Problem with TLC/TK on Ubuntu Jul 18, 2008 Roland Rau How to filter a data frame? Jul 22, 2008 Roland Rau Minor Bug in Documentation of merge() Jul 25, 2008 Roland Rau Dividing by 0 Jul 25, 2008 Roland Rau Case statements in R Jul 28, 2008 Roland Rau Legality Question about R's Open Source GNU GPL License Jul 28, 2008 Roland Rau Case statements in R Jul 29, 2008 Roland Rau R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 Roland Rau Random subset Jul 30, 2008 Roland Rau Random subset Jul 30, 2008

Rolf Turner

Last active: Jul 30, 2008
44 msgs
Rolf Turner Add comments on plot window Jun 30, 2008 Rolf Turner lm and NA Jun 30, 2008 Rolf Turner Messge ``no visible binding''. Jun 30, 2008 Rolf Turner W-E-I-R-D Weird! Jul 1, 2008 Rolf Turner Area Under a Curve Jul 1, 2008 Rolf Turner W-E-I-R-D Weird! Jul 1, 2008 Rolf Turner Ternaryplot function Jul 3, 2008 Rolf Turner Lots of huge matrices, for-loops, speed Jul 6, 2008 Rolf Turner Change in behaviour of sd() Jul 8, 2008 Rolf Turner sorting a data frame by rownames Jul 8, 2008 Rolf Turner rounding Jul 10, 2008 Rolf Turner Problems with Package Installation. Jul 10, 2008 Rolf Turner Off topic: Tcl/Tk outside R. Jul 13, 2008 Rolf Turner stem and leaf plot: how to edit the stem-values Jul 13, 2008 Rolf Turner Off topic: Tcl/Tk outside R. Jul 14, 2008 Rolf Turner .First and .Rprofile won't run on startup Jul 14, 2008 Rolf Turner Off topic: Tcl/Tk outside R. Jul 14, 2008 Rolf Turner Iterations Jul 15, 2008 Rolf Turner Stratified random sample Jul 16, 2008 Rolf Turner Stratified random sample Jul 16, 2008 Rolf Turner Matching Up Values Jul 17, 2008 Rolf Turner asp and ylim Jul 20, 2008 Rolf Turner Editor fpr Mac OS Jul 21, 2008 Rolf Turner Parameter names in nls Jul 21, 2008 Rolf Turner Table of tables? Jul 21, 2008 Rolf Turner help with simulate AR(1) data Jul 22, 2008 Rolf Turner help with simulate AR(1) data Jul 22, 2008 Rolf Turner Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008 Rolf Turner Erro: cannot allocate vector of size 216.0 Mb Jul 22, 2008 Rolf Turner Coefficients of Logistic Regression from bootstrap - how to get them? Jul 22, 2008 Rolf Turner how can I write code to detect whether the machine is Windows or Linux? Jul 23, 2008 Rolf Turner Dividing by 0 Jul 24, 2008 Rolf Turner Should this PDF render correctly without font embedding? Jul 24, 2008 Rolf Turner still more dumb questions Jul 24, 2008 Rolf Turner simple random number generation Jul 24, 2008 Rolf Turner Mixed model question. Jul 27, 2008 Rolf Turner Converting english words to numeric equivalents Jul 27, 2008 Rolf Turner read.table question Jul 27, 2008 Rolf Turner Mixed model question. Jul 28, 2008 Rolf Turner finding a faster way to do an iterative computation Jul 29, 2008 Rolf Turner R command history -- can it be like Matlab's? Jul 29, 2008 Rolf Turner placing a text in the corner of a plot Jul 29, 2008 Rolf Turner FFT - (STATS) - is this correct? Jul 30, 2008 Rolf Turner dotFirst option Jul 30, 2008

Romain

Last active: Jul 21, 2008
1 msg
Romain Creation of png=problems Jul 21, 2008

Ron Michael

Last active: Jul 3, 2008
3 msgs
Ron Michael as.Date() clarification Jul 3, 2008 Ron Michael A regression problem using dummy variables Jul 3, 2008 Ron Michael A regression problem using dummy variables Jul 3, 2008

Rory Winston

Last active: Jul 3, 2008
2 msgs
Rory Winston Plotting Prediction Surface with persp() Jul 2, 2008 Rory Winston Plotting Prediction Surface with persp() Jul 3, 2008

Rossouw, Ruan (RF)

Last active: Jul 22, 2008
1 msg
Rossouw, Ruan (RF) Opening files from R terminal - appologies Jul 22, 2008

Rune Haubo

Last active: Jul 17, 2008
1 msg
Rune Haubo Likelihood ratio test between glm and glmer fits Jul 17, 2008

Russell Ivory

Last active: Jul 10, 2008
1 msg
Russell Ivory by() function doesn't work inside another function Jul 10, 2008

Ryan Sheftel

Last active: Jul 2, 2008
2 msgs
Ryan Sheftel plot.zoo labels Jul 1, 2008 Ryan Sheftel plot.zoo labels Jul 2, 2008

S Ellison

Last active: Jul 24, 2008
5 msgs
S Ellison Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008 S Ellison How to change labels in a histogram Jul 8, 2008 S Ellison Expression in axis Jul 9, 2008 S Ellison "Reasonable doubt" - was "Re: shapiro wilk normality test" Jul 14, 2008 S Ellison simple random number generation Jul 24, 2008

S. M. Niaz Arifin

Last active: Jul 24, 2008
1 msg
S. M. Niaz Arifin Fit a 3-Dimensional Line to Data Points Jul 24, 2008

SH.Chou

Last active: Jul 18, 2008
1 msg
SH.Chou function "eigen" AND Minitab Jul 18, 2008

Sam Albers

Last active: Jul 10, 2008
10 msgs
Sam Albers Graph Order in xyplot Jul 1, 2008 Sam Albers Graph Order in xyplot Jul 1, 2008 Sam Albers Numbers as Points in Graphs Jul 6, 2008 Sam Albers Numbers as Points in Graphs Jul 6, 2008 Sam Albers Numbers as Points in Graphs Jul 6, 2008 Sam Albers Grid building in R Jul 9, 2008 Sam Albers Grid building in R Jul 9, 2008 Sam Albers Grid building in R Jul 9, 2008 Sam Albers Grid building in R Jul 9, 2008 Sam Albers Problems with Package Installation. Jul 10, 2008

Sam Stewart

Last active: Jul 3, 2008
1 msg
Sam Stewart cross-validation in rpart Jul 3, 2008

Sarah Goslee

Last active: Jul 29, 2008
11 msgs
Sarah Goslee A question about using function plot Jul 14, 2008 Sarah Goslee manipulating (extracting) data from distance matrices Jul 15, 2008 Sarah Goslee par("din") vs dev.size() Jul 18, 2008 Sarah Goslee Opening files from R terminal - appologies Jul 22, 2008 Sarah Goslee Function Error Jul 22, 2008 Sarah Goslee Saving a workspace with "extras"? Jul 25, 2008 Sarah Goslee loop does not work Jul 28, 2008 Sarah Goslee Graphics function question Jul 29, 2008 Sarah Goslee accessing list elements Jul 29, 2008 Sarah Goslee Graphics function question Jul 29, 2008 Sarah Goslee List names help Jul 29, 2008

Sascha Bellaire

Last active: Jul 20, 2008
1 msg
Sascha Bellaire Indicator Kriging? Jul 20, 2008

Satoshi Takahama

Last active: Jul 31, 2008
7 msgs
Satoshi Takahama Plot Mixtures of Synthetically Generated Gamma Distributions Jul 6, 2008 Satoshi Takahama Method for checking automatically which distribtions fits a data Jul 7, 2008 Satoshi Takahama help with data layout Jul 17, 2008 Satoshi Takahama Colors in Sweave Jul 27, 2008 Satoshi Takahama Object-oriented programming in R for Java programmers? Jul 27, 2008 Satoshi Takahama Object-oriented programming in R for Java programmers? Jul 27, 2008 Satoshi Takahama Storing Matrices into Hash Jul 31, 2008

Schleuh

Last active: Jul 10, 2008
2 msgs
Schleuh Change language in Rcmdr Jul 7, 2008 Schleuh re ad.table problem Jul 10, 2008

Schragi Schwartz

Last active: Jul 12, 2008
1 msg
Schragi Schwartz Visualization of multiple alignments Jul 12, 2008

Scott Brown

Last active: Jul 2, 2008
1 msg
Scott Brown Can't install package Matrix on solaris. Jul 2, 2008

Sean Davis

Last active: Jul 9, 2008
2 msgs
Sean Davis gsub and "\" Jul 9, 2008 Sean Davis gsub and "\" Jul 9, 2008

Sean O'Riordain

Last active: Jul 25, 2008
1 msg
Sean O'Riordain discrete event simulation - "factory" with rework Jul 25, 2008

Sebastian Merz

Last active: Jul 7, 2008
1 msg
Sebastian Merz indicating significant differences in boxplots Jul 7, 2008

Sebastian Weber

Last active: Jul 21, 2008
2 msgs
Sebastian Weber column wise paste of data.frames Jul 18, 2008 Sebastian Weber xyplot: distance between axis and axis-label gets wrong Jul 21, 2008

Senthil Purushothaman

Last active: Jul 24, 2008
4 msgs
Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 18, 2008 Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 19, 2008 Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 22, 2008 Senthil Purushothaman Calculating Betweenness - Efficiency problem Jul 24, 2008

Sergi M.Garrido

Last active: Jul 8, 2008
1 msg
Sergi M.Garrido R package Jul 8, 2008

Seyed Reza Jafarzadeh

Last active: Jul 3, 2008
1 msg
Seyed Reza Jafarzadeh dgamma in WinBUGS and JAGS (rjags) Jul 3, 2008

Shige Song

Last active: Jul 22, 2008
1 msg
Shige Song Editor for Mac Jul 22, 2008

Shirin Safa

Last active: Jul 10, 2008
4 msgs
Shirin Safa Fitting a curve to data Jul 1, 2008 Shirin Safa Fitting a curve to data Jul 1, 2008 Shirin Safa garchFit problem Jul 9, 2008 Shirin Safa predict.garch problem Jul 10, 2008

Shubha Vishwanath Karanth

Last active: Jul 30, 2008
9 msgs
Shubha Vishwanath Karanth Sum(Random Numbers)=100 Jul 7, 2008 Shubha Vishwanath Karanth Sum(Random Numbers)=100 Jul 7, 2008 Shubha Vishwanath Karanth A neural network problem---neuralnet package Jul 18, 2008 Shubha Vishwanath Karanth Simple... but... Jul 23, 2008 Shubha Vishwanath Karanth Simple... but... Jul 23, 2008 Shubha Vishwanath Karanth Simple... but... Jul 23, 2008 Shubha Vishwanath Karanth sequential sum of a vector... Jul 23, 2008 Shubha Vishwanath Karanth sequential sum of a vector... Jul 23, 2008 Shubha Vishwanath Karanth "dens" function Jul 30, 2008

Shuhua Zhan

Last active: Jul 11, 2008
1 msg
Shuhua Zhan modified ks.test? Jul 11, 2008

Silika Prohl

Last active: Jul 3, 2008
1 msg
Silika Prohl (no subject) Jul 3, 2008

Simon Anders

Last active: Jul 19, 2008
2 msgs
Simon Anders t-test for multiple variables Jul 18, 2008 Simon Anders t-test for multiple variables Jul 19, 2008

Simon Blomberg

Last active: Jul 14, 2008
2 msgs
Simon Blomberg modeling binary response variables Jul 14, 2008 Simon Blomberg modeling binary response variables Jul 14, 2008

Sofia Martinez

Last active: Jul 28, 2008
2 msgs
Sofia Martinez Help with a loop Jul 27, 2008 Sofia Martinez Help with a loop Jul 28, 2008

Somesan, Ileana

Last active: Jul 28, 2008
1 msg
Somesan, Ileana multiv Jul 28, 2008

Soumyadeep Nandi

Last active: Jul 3, 2008
3 msgs
Soumyadeep Nandi randomForest training error Jul 2, 2008 Soumyadeep Nandi randomForest.error: length of response must be the same as predictors Jul 2, 2008 Soumyadeep Nandi randomForest.error: length of response must be the same as predictors Jul 3, 2008

Spencer

Last active: Jul 24, 2008
2 msgs
Spencer Recoding a variable Jul 3, 2008 Spencer Question: how to build a subset to do separate calculations Jul 24, 2008

Spencer Graves

Last active: Jul 29, 2008
10 msgs
Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 4, 2008 Spencer Graves Test for multiple comparisons: Nonlinear model, autocorrelation? Jul 6, 2008 Spencer Graves Functional Data Analysis, fda_1.2.4 Jul 6, 2008 Spencer Graves Operator overloading Jul 10, 2008 Spencer Graves R bug in the update of nlme? Jul 11, 2008 Spencer Graves smooth.spline Jul 17, 2008 Spencer Graves smooth.spline Jul 18, 2008 Spencer Graves smooth.spline Jul 20, 2008 Spencer Graves smooth.spline Jul 20, 2008 Spencer Graves R command history -- can it be like Matlab's? Jul 29, 2008

Stacey Burrows

Last active: Jul 11, 2008
1 msg
Stacey Burrows reading in a subset of a large data set Jul 11, 2008

Stas Kolenikov

Last active: Jul 27, 2008
1 msg
Stas Kolenikov Link functions in SEM Jul 27, 2008

Stefan Evert

Last active: Jul 31, 2008
2 msgs
Stefan Evert Case statements in R Jul 28, 2008 Stefan Evert instal tar.gz package on windows Jul 31, 2008

Stephan Kolassa

Last active: Jul 17, 2008
6 msgs
Stephan Kolassa Recoding a variable Jul 3, 2008 Stephan Kolassa Backslash in sub pattern? Jul 14, 2008 Stephan Kolassa Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008 Stephan Kolassa Sweave, backslash in sub pattern? was: Backslash in sub pattern? Jul 14, 2008 Stephan Kolassa Iterations Jul 15, 2008 Stephan Kolassa Display variables when running a script Jul 17, 2008

Stephane Bourgeois

Last active: Jul 8, 2008
1 msg
Stephane Bourgeois attributing values to dataframe positions following eval Jul 8, 2008

Stephen Bond

Last active: Jul 14, 2008
1 msg
Stephen Bond dll problem Jul 14, 2008

Stephen Kennedy

Last active: Jul 18, 2008
1 msg
Stephen Kennedy dataedit Jul 18, 2008

Steve Cadman

Last active: Jul 1, 2008
1 msg
Steve Cadman Installing R into home directory? Jul 1, 2008

Steve Frost

Last active: Jul 15, 2008
1 msg
Steve Frost Simulate data with binary outcome Jul 15, 2008

Steve Murray

Last active: Jul 31, 2008
10 msgs
Steve Murray Melt (reshape) question Jul 15, 2008 Steve Murray Melt (reshape) question Jul 15, 2008 Steve Murray Matching Up Values Jul 17, 2008 Steve Murray Matching Up Values Jul 18, 2008 Steve Murray Matching Up Values Jul 20, 2008 Steve Murray Coarsening the Resolution of a Dataset Jul 26, 2008 Steve Murray Coarsening the Resolution of a Dataset Jul 29, 2008 Steve Murray Coarsening the Resolution of a Dataset Jul 30, 2008 Steve Murray Coarsening the Resolution of a Dataset Jul 30, 2008 Steve Murray Coarsening the Resolution of a Dataset Jul 31, 2008

Steven McKinney

Last active: Jul 31, 2008
3 msgs
Steven McKinney Calling LISP programs in R Jul 23, 2008 Steven McKinney 64-bit R on Mac OS X 10.4.5 Jul 25, 2008 Steven McKinney sort rows of matrix by rows of another matrix Jul 31, 2008

Stuart Nettleton

Last active: Jul 19, 2008
3 msgs
Stuart Nettleton Equation sequencing Jul 18, 2008 Stuart Nettleton How to solve systems of nonlinear equations in R? Jul 18, 2008 Stuart Nettleton Non-linearly constrained optimisation Jul 19, 2008

Surendra champanerkar

Last active: Jul 14, 2008
1 msg
Surendra champanerkar How to load stats4 package Jul 14, 2008

Susan Amrose

Last active: Jul 15, 2008
2 msgs
Susan Amrose .First and .Rprofile won't run on startup Jul 14, 2008 Susan Amrose .First and .Rprofile won't run on startup Jul 15, 2008

Susana Esteves

Last active: Jul 10, 2008
1 msg
Susana Esteves R bug in the update of nlme? Jul 10, 2008

Sylvain ARCHENAULT

Last active: Jul 25, 2008
1 msg
Sylvain ARCHENAULT S4 class and Package NAMESPACE [NC] Jul 25, 2008

Sébastien Bihorel

Last active: Jul 18, 2008
2 msgs
Sébastien Bihorel passing a variable at the command line Jul 1, 2008 Sébastien Bihorel using which to identify a range of values Jul 18, 2008

Søren Højsgaard

Last active: Jul 12, 2008
3 msgs
Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008 Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008 Søren Højsgaard How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008

TL Vincent

Last active: Jul 24, 2008
1 msg
TL Vincent Multinomial logistic regression with non-numerical data. Jul 24, 2008

Tanya Yatsunenko

Last active: Jul 1, 2008
1 msg
Tanya Yatsunenko PCA : Error in eigen(cv, Jul 1, 2008

Tariq Perwez

Last active: Jul 15, 2008
1 msg
Tariq Perwez Help Updating and Installing R Packages Jul 15, 2008

Ted

Last active: Jul 9, 2008
2 msgs
Ted First attempt to use R Jul 3, 2008 Ted Help navigating documentation for descriptive statistics Jul 9, 2008

Ted Rosenbaum

Last active: Jul 31, 2008
1 msg
Ted Rosenbaum Problem with RSPython Jul 31, 2008

Terry Therneau

Last active: Jul 7, 2008
5 msgs
Terry Therneau cohort sampling Jul 1, 2008 Terry Therneau survival package test stats Jul 3, 2008 Terry Therneau Tobit Estimation with Panel Data Jul 3, 2008 Terry Therneau cross-validation in rpart Jul 7, 2008 Terry Therneau Relative Mortality Risk second part Jul 7, 2008

Thaden, John J

Last active: Jul 12, 2008
3 msgs
Thaden, John J Position in a vector of the last value > n Jul 10, 2008 Thaden, John J Position in a vector of the last value > n - *SOLVED* Jul 11, 2008 Thaden, John J Position in a vector of the last value > n - *SOLVED* Jul 12, 2008

Thiago Cortez Costa

Last active: Jul 14, 2008
1 msg
Thiago Cortez Costa nlme, lme( ) convergence and selection of effects Jul 14, 2008

Thiago Souza

Last active: Jul 19, 2008
1 msg
Thiago Souza Resshufling algorithm (Thiago Souza) Jul 19, 2008

Thibaut Jombart

Last active: Jul 7, 2008
1 msg
Thibaut Jombart How can i do an automatic upgrade of R 2.5.1 to R 2.7.1 Jul 7, 2008

Thiemo Schreiber

Last active: Jul 7, 2008
1 msg
Thiemo Schreiber one-site competition data // curve fitting Jul 7, 2008

Thomas Adams

Last active: Jul 2, 2008
2 msgs
Thomas Adams W-E-I-R-D Weird! Jul 2, 2008 Thomas Adams W-E-I-R-D Weird! Jul 2, 2008

Thomas E

Last active: Jul 31, 2008
1 msg
Thomas E Code to calculate internal rate of return Jul 31, 2008

Thomas Fröjd

Last active: Jul 15, 2008
4 msgs
Thomas Fröjd Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008 Thomas Fröjd Need ideas on how to show spikes in my data and how to code it in R Jul 8, 2008 Thomas Fröjd Layers in graphs Jul 15, 2008 Thomas Fröjd Layers in graphs Jul 15, 2008

Thomas Frööjd

Last active: Jul 7, 2008
1 msg
Thomas Frööjd RES: Need ideas on how to show spikes in my data and how to codeit in R Jul 7, 2008

Thomas Hoffmann

Last active: Jul 22, 2008
1 msg
Thomas Hoffmann determing font type in expression Jul 22, 2008

Thomas Lumley

Last active: Jul 2, 2008
2 msgs
Thomas Lumley WIERD: Basic computing in R Jul 1, 2008 Thomas Lumley A regression problem using dummy variables Jul 2, 2008

Tim Hesterberg

Last active: Jul 27, 2008
1 msg
Tim Hesterberg Coefficients of Logistic Regression from bootstrap - how to get them? Jul 27, 2008

Timo Stolz

Last active: Jul 14, 2008
1 msg
Timo Stolz how to correlate nominal variables? Jul 14, 2008

Timothy W. Hilton

Last active: Jul 31, 2008
1 msg
Timothy W. Hilton sort rows of matrix by rows of another matrix Jul 31, 2008

Tine

Last active: Jul 10, 2008
1 msg
Tine Operator overloading Jul 10, 2008

Tine Mlac

Last active: Jul 3, 2008
1 msg
Tine Mlac L1 nonlinear approximation Jul 3, 2008

Tobias Verbeke

Last active: Jul 23, 2008
8 msgs
Tobias Verbeke A quick question about lm() Jul 7, 2008 Tobias Verbeke Survey questions Jul 8, 2008 Tobias Verbeke childNames for xaxis grob (grid package) Jul 9, 2008 Tobias Verbeke Find the closest value in a list or matrix Jul 9, 2008 Tobias Verbeke childNames for xaxis grob (grid package) Jul 10, 2008 Tobias Verbeke Sorting / editing a table Jul 10, 2008 Tobias Verbeke CART Analysis Jul 21, 2008 Tobias Verbeke Point-biserial correlation Jul 23, 2008

Tolga Uzuner

Last active: Jul 19, 2008
2 msgs
Tolga Uzuner Title for graph with multiple plots Jul 19, 2008 Tolga Uzuner Title for graph with multiple plots Jul 19, 2008

Tom La Bone

Last active: Jul 27, 2008
6 msgs
Tom La Bone Backgrounds in Multiple Plots made with "fig" Jul 6, 2008 Tom La Bone Problem with scatterplot3d example Jul 24, 2008 Tom La Bone Tutorial on rgl Graphics Jul 25, 2008 Tom La Bone Tutorial on rgl Graphics Jul 25, 2008 Tom La Bone Tutorial on rgl Graphics Jul 25, 2008 Tom La Bone re sponse surface analysis Jul 27, 2008

Tom Love

Last active: Jul 15, 2008
1 msg
Tom Love New Zealand Maps Jul 15, 2008

Tom.O

Last active: Jul 30, 2008
1 msg
Tom.O R GUI help Jul 30, 2008

Tomas Lanczos

Last active: Jul 22, 2008
2 msgs
Tomas Lanczos Change legend in the 'hydrogeo' package Jul 8, 2008 Tomas Lanczos saving plot both as jpg and pdf Jul 22, 2008

Tony Plate

Last active: Jul 21, 2008
1 msg
Tony Plate name returned by lapply Jul 21, 2008

Troels Ring

Last active: Jul 29, 2008
5 msgs
Troels Ring lattice smooth Jul 5, 2008 Troels Ring lattice smooth problem? Jul 6, 2008 Troels Ring R2WinBUGS problem Jul 23, 2008 Troels Ring R2WinBUGS problem Jul 24, 2008 Troels Ring lattice question Jul 29, 2008

Tsjerk Wassenaar

Last active: Jul 17, 2008
1 msg
Tsjerk Wassenaar matrix multiplication question Jul 17, 2008

Tudor Bodea

Last active: Jul 17, 2008
2 msgs
Tudor Bodea Exception Handling Jul 6, 2008 Tudor Bodea Hiding information about functions in newly developed packages Jul 17, 2008

Udaya B. Kogalur

Last active: Jul 28, 2008
1 msg
Udaya B. Kogalur randomSurvivalForest 3.5.0 now available Jul 28, 2008

Ulrich Leopold

Last active: Jul 5, 2008
2 msgs
Ulrich Leopold update search path for attached data Jul 4, 2008 Ulrich Leopold update search path for attached data Jul 5, 2008

Ulrike Grömping

Last active: Jul 9, 2008
2 msgs
Ulrike Grömping Question regarding lu in package Matrix Jul 9, 2008 Ulrike Grömping Question regarding lu in package Matrix Jul 9, 2008

Uwe Ligges

Last active: Jul 29, 2008
24 msgs
Uwe Ligges Problem with loading library-ks Jul 2, 2008 Uwe Ligges Sunset in Dortmund Jul 3, 2008 Uwe Ligges Another packaging question Jul 12, 2008 Uwe Ligges How to build a package which loads Rgraphviz (if installed)... Jul 13, 2008 Uwe Ligges R crash with ATLAS precompiled Rblas.dll on Windows XP Core2 Duo Jul 13, 2008 Uwe Ligges Installing RWinEdt Jul 13, 2008 Uwe Ligges Another packaging question Jul 13, 2008 Uwe Ligges Installing RWinEdt Jul 14, 2008 Uwe Ligges Function to create variables with prefix Jul 15, 2008 Uwe Ligges how i can install Rgraphviz in R2.7.1 Jul 17, 2008 Uwe Ligges plot(linear model) without lines Jul 17, 2008 Uwe Ligges REvolution computing Jul 18, 2008 Uwe Ligges drawing segments through points with pch=1 Jul 20, 2008 Uwe Ligges Erro updating HTML package descriptions in packages.html Jul 20, 2008 Uwe Ligges Erro: cannot allocate vector of size 216.0 Mb Jul 21, 2008 Uwe Ligges Problem with scatterplot3d example Jul 24, 2008 Uwe Ligges problem in choosing cran mirror ! Jul 25, 2008 Uwe Ligges Bug in gap.plot Jul 25, 2008 Uwe Ligges Integrating R and Textmate Jul 25, 2008 Uwe Ligges path and R CMD check Jul 25, 2008 Uwe Ligges cannot allocate vector of size... Jul 25, 2008 Uwe Ligges R2WinBUGS problem Jul 25, 2008 Uwe Ligges R-package install Jul 26, 2008 Uwe Ligges Installing BRugs Jul 29, 2008

Vadim Kutsyy

Last active: Jul 31, 2008
2 msgs
Vadim Kutsyy allocMatrix limits Jul 31, 2008 Vadim Kutsyy allocMatrix limits Jul 31, 2008

Vadim Ogranovich

Last active: Jul 23, 2008
1 msg
Vadim Ogranovich shQuote and cat Jul 23, 2008

Valentino Botta

Last active: Jul 3, 2008
1 msg
Valentino Botta Matrix set value problem Jul 3, 2008

Van Wyk, Jaap

Last active: Jul 25, 2008
4 msgs
Van Wyk, Jaap R version 2.7.1 (warnings) Jul 19, 2008 Van Wyk, Jaap R version 2.7.1 (warnings) Jul 20, 2008 Van Wyk, Jaap Help with rep Jul 25, 2008 Van Wyk, Jaap Help with matrix Jul 25, 2008

Vicki Meng

Last active: Jul 22, 2008
2 msgs
Vicki Meng F test Jul 22, 2008 Vicki Meng F test Jul 22, 2008

Vidhu Choudhary

Last active: Jul 22, 2008
2 msgs
Vidhu Choudhary RSQLite maximum table size Jul 16, 2008 Vidhu Choudhary Reading the data from specific columns Jul 22, 2008

Viet Le

Last active: Jul 1, 2008
1 msg
Viet Le Survival Analysis questions Jul 1, 2008

Vikas Rawal

Last active: Jul 1, 2008
1 msg
Vikas Rawal Fitting a curve to data Jul 1, 2008

VinceD

Last active: Jul 10, 2008
3 msgs
VinceD build matrix with the content of one column of a data frame in function of two factors Jul 9, 2008 VinceD build matrix with the content of one column of a data frame in function of two factors Jul 9, 2008 VinceD build matrix with the content of one column of a data frame in function of two factors Jul 10, 2008

Vincent Goulet

Last active: Jul 30, 2008
7 msgs
Vincent Goulet version problems of rkward in ubuntu hardy repository Jul 9, 2008 Vincent Goulet Another failed attempt to install an R package in Ubuntu Jul 12, 2008 Vincent Goulet Insurance review statistical methods Jul 15, 2008 Vincent Goulet Help Updating and Installing R Packages Jul 15, 2008 Vincent Goulet Graphics not working for R in ubuntu Jul 19, 2008 Vincent Goulet Histogram Jul 23, 2008 Vincent Goulet best quad core configuration? Jul 30, 2008

Viswanathan Shankar

Last active: Jul 2, 2008
1 msg
Viswanathan Shankar Reading CSV file with unequal record length Jul 2, 2008

Vitalie S.

Last active: Jul 3, 2008
1 msg
Vitalie S. Lattice: reasons for not passing subscripted "col", "pch", "lty", "fill" to panel functions Jul 3, 2008

Vorlow Constantinos

Last active: Jul 8, 2008
2 msgs
Vorlow Constantinos Combining playwith with par(mfrow... ) i.e., multiple plots. Jul 2, 2008 Vorlow Constantinos forecast & xreg Jul 8, 2008

Víctor Homar Santaner

Last active: Jul 9, 2008
1 msg
Víctor Homar Santaner "Rotated Lat-Lon" projection in mapproj Jul 9, 2008

Wacek Kusnierczyk

Last active: Jul 24, 2008
12 msgs
Wacek Kusnierczyk Find classes of each column of data.frame() Jul 1, 2008 Wacek Kusnierczyk trivial list question Jul 1, 2008 Wacek Kusnierczyk recursively divide a value to get a sequence Jul 9, 2008 Wacek Kusnierczyk Sorting / editing a table Jul 10, 2008 Wacek Kusnierczyk spliting a string Jul 17, 2008 Wacek Kusnierczyk Simple... but... Jul 23, 2008 Wacek Kusnierczyk Simple... but... Jul 23, 2008 Wacek Kusnierczyk Simple... but... Jul 23, 2008 Wacek Kusnierczyk Simple... but... Jul 23, 2008 Wacek Kusnierczyk convert a vector of words into a matrix Jul 24, 2008 Wacek Kusnierczyk convert a vector of words into a matrix Jul 24, 2008 Wacek Kusnierczyk incrementing for loop by 2 Jul 24, 2008

Wade Wall

Last active: Jul 28, 2008
1 msg
Wade Wall Case statements in R Jul 28, 2008

Werner Wernersen

Last active: Jul 27, 2008
1 msg
Werner Wernersen Object-oriented programming in R for Java programmers? Jul 27, 2008

Wesley Roberts

Last active: Jul 28, 2008
1 msg
Wesley Roberts Help with yaImpute Jul 28, 2008

Willa Wei

Last active: Jul 14, 2008
2 msgs
Willa Wei Data Manipulations and SQL Jul 14, 2008 Willa Wei Convert data set to data frame Jul 14, 2008

William Pepe

Last active: Jul 22, 2008
2 msgs
William Pepe Help with rearranging data Jul 22, 2008 William Pepe Help with rearranging data Jul 22, 2008

William Revelle

Last active: Jul 23, 2008
5 msgs
William Revelle Summary Stats (not summary(x)) Jul 9, 2008 William Revelle How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008 William Revelle How to build a package which loads Rgraphviz (if installed)... Jul 12, 2008 William Revelle sequential sum of a vector... Jul 23, 2008 William Revelle Point-biserial correlation Jul 23, 2008

Williams Scott

Last active: Jul 24, 2008
1 msg
Williams Scott ggplot question Jul 24, 2008

Williams, Robin

Last active: Jul 30, 2008
8 msgs
Williams, Robin Subsetting data by date Jul 21, 2008 Williams, Robin Subsetting data by date Jul 21, 2008 Williams, Robin Subsetting data by date Jul 21, 2008 Williams, Robin Opening files from R terminal - appologies Jul 22, 2008 Williams, Robin Ignore previous emails Jul 22, 2008 Williams, Robin Is there an equivalent * operator? Jul 24, 2008 Williams, Robin Just 2 more questions - for now! Jul 24, 2008 Williams, Robin Bizarre - R crashes on merge Jul 30, 2008

Wim Bertels

Last active: Jul 31, 2008
2 msgs
Wim Bertels odds ratios in multiway tables (stratified) Jul 30, 2008 Wim Bertels odds ratios in multiway tables (stratified) Jul 31, 2008

Wolfgang Huber

Last active: Jul 15, 2008
5 msgs
Wolfgang Huber Subsetting an array by a vector of dimensions Jul 11, 2008 Wolfgang Huber Subsetting an array by a vector of dimensions Jul 11, 2008 Wolfgang Huber Analysis of poorly replicated array data Jul 14, 2008 Wolfgang Huber question about a small "for" loop Jul 14, 2008 Wolfgang Huber counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT" Jul 15, 2008

Wolfgang Raffelsberger

Last active: Jul 2, 2008
1 msg
Wolfgang Raffelsberger Plotting Bi-Gamma Distribution Jul 2, 2008

Woolner, Keith

Last active: Jul 14, 2008
3 msgs
Woolner, Keith More compact form of lm object that can be used for prediction? Jul 11, 2008 Woolner, Keith More compact form of lm object that can be used for prediction? Jul 11, 2008 Woolner, Keith More compact form of lm object that can be used for prediction? Jul 14, 2008

Wu, Hong-Sheng

Last active: Jul 10, 2008
1 msg
Wu, Hong-Sheng princomp loading help Jul 10, 2008

Xiaohui Chen

Last active: Jul 7, 2008
1 msg
Xiaohui Chen Basic Vector and Matrix Operations Jul 7, 2008

Xin Shi

Last active: Jul 17, 2008
1 msg
Xin Shi histogram plot default Jul 17, 2008

XinMeng

Last active: Jul 23, 2008
1 msg
XinMeng how to export ".xls" file with colorful cells? Jul 23, 2008

Yasir Kaheil

Last active: Jul 28, 2008
5 msgs
Yasir Kaheil outlining symbol in legend with blackline Jul 9, 2008 Yasir Kaheil netCDF to TIFF Jul 9, 2008 Yasir Kaheil Insurance review statistical methods Jul 15, 2008 Yasir Kaheil Is there way to multiple plots on gap.plot? Jul 28, 2008 Yasir Kaheil Fill in NA values in vector with previous character/factor Jul 28, 2008

Yinny

Last active: Jul 5, 2008
1 msg
Yinny Different Autocorrelation using R and other softwares Jul 5, 2008

Yogesh Tiwari

Last active: Jul 16, 2008
1 msg
Yogesh Tiwari date to decimal date conversion Jul 16, 2008

Youngik Yang

Last active: Jul 24, 2008
1 msg
Youngik Yang Error - unable to load shared library Jul 24, 2008

Yunlei.Hu at barclayscapital.com

Last active: Jul 22, 2008
2 msgs
Yunlei.Hu at barclayscapital.com A question on the quandratic programming Jul 21, 2008 Yunlei.Hu at barclayscapital.com Urgent Jul 22, 2008

Yupu Liang

Last active: Jul 18, 2008
1 msg
Yupu Liang copy number estimation through oligo package? Jul 18, 2008

Yuri Volchik

Last active: Jul 9, 2008
1 msg
Yuri Volchik ftp directory Jul 9, 2008

Zarza

Last active: Jul 6, 2008
1 msg
Zarza Lots of huge matrices, for-loops, speed Jul 6, 2008

Zhang Yanwei - Princeton-MRAm

Last active: Jul 31, 2008
8 msgs
Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008 Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008 Zhang Yanwei - Princeton-MRAm Questions on weighted least squares Jul 23, 2008 Zhang Yanwei - Princeton-MRAm pca Jul 25, 2008 Zhang Yanwei - Princeton-MRAm Numerical question Jul 25, 2008 Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 30, 2008 Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 31, 2008 Zhang Yanwei - Princeton-MRAm Sampling two exponentials Jul 31, 2008

Zheng Lu

Last active: Jul 26, 2008
2 msgs
Zheng Lu help appreciated to make a plot Jul 2, 2008 Zheng Lu issues with gap.plot function Jul 26, 2008

Zhesi He

Last active: Jul 29, 2008
1 msg
Zhesi He mac install no font found problem in quartz display Jul 29, 2008

Zornitsa Luleva

Last active: Jul 23, 2008
2 msgs
Zornitsa Luleva Control parameter of the optim( ): parscale Jul 21, 2008 Zornitsa Luleva mle2(): logarithm of negative pdfs Jul 23, 2008

Zroutik Zroutik

Last active: Jul 15, 2008
6 msgs
Zroutik Zroutik Turn any vector Jul 10, 2008 Zroutik Zroutik Turn any vector Jul 10, 2008 Zroutik Zroutik ampersand char in the path causing error message when running rscript.bat Jul 14, 2008 Zroutik Zroutik creating axis of the plot before data are plotted Jul 14, 2008 Zroutik Zroutik creating axis of the plot before data are plotted Jul 14, 2008 Zroutik Zroutik creating axis of the plot before data are plotted -- solved Jul 15, 2008

abdul kudus

Last active: Jul 14, 2008
1 msg
abdul kudus Robust Buckley-James like estimator Jul 14, 2008

ae2356 at hotmail.com

Last active: Jul 21, 2008
1 msg
ae2356 at hotmail.com xyplot help Jul 21, 2008

ajay ohri

Last active: Jul 31, 2008
8 msgs
ajay ohri data summerization etc... Jul 11, 2008 ajay ohri Matrix barplot Jul 25, 2008 ajay ohri Major Cloud Computing Testbed Announced at University of Illinois Jul 29, 2008 ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 ajay ohri R -Legality Question about R's Open Source GNU GPL License Jul 30, 2008 ajay ohri OT: Data mining on demand .Using cloud computers. Jul 30, 2008 ajay ohri OT:Selling Data Mining Cloud-A Concept Jul 31, 2008

alessia matano

Last active: Jul 10, 2008
2 msgs
alessia matano problems with rq.fit.sfn Jul 10, 2008 alessia matano problems with rq.fit.sfn Jul 10, 2008

andrewjacksonTCD

Last active: Jul 10, 2008
1 msg
andrewjacksonTCD Non-normal data issues in PhD software engineering experiment Jul 10, 2008

anna freni sterrantino

Last active: Jul 22, 2008
1 msg
anna freni sterrantino Function Error Jul 22, 2008

apjaworski@mmm.com

Last active: Jul 7, 2008
1 msg
apjaworski@mmm.com Basic Vector and Matrix Operations Jul 7, 2008

arezoo bagheri

Last active: Jul 16, 2008
1 msg
arezoo bagheri R-source code of a function Jul 16, 2008

arghya ganguli

Last active: Jul 3, 2008
1 msg
arghya ganguli Data size Jul 3, 2008

ascentnet

Last active: Jul 26, 2008
3 msgs
ascentnet Accessing individual variables from summary of lm Jul 21, 2008 ascentnet Accessing individual variables from summary of lm Jul 22, 2008 ascentnet Add a Vector to a Matrix Jul 26, 2008

aude Valade

Last active: Jul 28, 2008
1 msg
aude Valade loop does not work Jul 28, 2008

bbouling

Last active: Jul 31, 2008
1 msg
bbouling Significance of confidence intervals in the Non-Linear Least Squares Program. Jul 31, 2008

calundergrad

Last active: Jul 31, 2008
1 msg
calundergrad cutting out numbers from vectors Jul 31, 2008

carol white

Last active: Jul 20, 2008
2 msgs
carol white problem with read.table Jul 20, 2008 carol white problem with read.table Jul 20, 2008

cathelf

Last active: Jul 22, 2008
1 msg
cathelf help with simulate AR(1) data Jul 22, 2008

cindy Guo

Last active: Jul 25, 2008
4 msgs
cindy Guo truncated normal Jul 23, 2008 cindy Guo R-package install Jul 24, 2008 cindy Guo R-package install Jul 24, 2008 cindy Guo R-package install Jul 25, 2008

cmr.Pent at gmail.com

Last active: Jul 15, 2008
2 msgs
cmr.Pent at gmail.com enscript states file for R scripts? Jul 14, 2008 cmr.Pent at gmail.com enscript states file for R scripts? Jul 15, 2008

cnagy

Last active: Jul 21, 2008
1 msg
cnagy Mclust - which cluster is each observation in? Jul 21, 2008

collonil

Last active: Jul 8, 2008
1 msg
collonil time series by calendar week Jul 8, 2008

ctu at bigred.unl.edu

Last active: Jul 30, 2008
19 msgs
ctu at bigred.unl.edu NLME questions -- interpretation of results Jul 2, 2008 ctu at bigred.unl.edu NLME questions -- interpretation of results Jul 2, 2008 ctu at bigred.unl.edu Matrix set value problem Jul 3, 2008 ctu at bigred.unl.edu looking for alternative of 'if-else' Jul 6, 2008 ctu at bigred.unl.edu looking for alternative of 'if-else' Jul 6, 2008 ctu at bigred.unl.edu Method for checking automatically which distribtions fits a data Jul 6, 2008 ctu at bigred.unl.edu GLM, LMER, GEE interpretation Jul 7, 2008 ctu at bigred.unl.edu extracting index list when using tapply() Jul 8, 2008 ctu at bigred.unl.edu extracting index list when using tapply() Jul 8, 2008 ctu at bigred.unl.edu Loglikelihood for x factorial? Jul 8, 2008 ctu at bigred.unl.edu What's the T-Value in fisher.test Jul 10, 2008 ctu at bigred.unl.edu rounding Jul 10, 2008 ctu at bigred.unl.edu How to output 0.405852702657738 as 0.405853 ? Jul 10, 2008 ctu at bigred.unl.edu create multi windows plot at the same time Jul 25, 2008 ctu at bigred.unl.edu R: create multi windows plot at the same time Jul 25, 2008 ctu at bigred.unl.edu About clustering techniques Jul 29, 2008 ctu at bigred.unl.edu Repeated Measure ANOVA-Old question Jul 29, 2008 ctu at bigred.unl.edu Re peated Measure ANOVA-Old question Jul 30, 2008 ctu at bigred.unl.edu Mixed effects model where nested factor is not the repeated across treatments lme??? Jul 30, 2008

deepti nigam

Last active: Jul 24, 2008
1 msg
deepti nigam problem in choosing cran mirror ! Jul 24, 2008

dej500 at york.ac.uk

Last active: Jul 19, 2008
1 msg
dej500 at york.ac.uk fixed effect significance with lmer() vs. t-test Jul 19, 2008

denise xifaras

Last active: Jul 23, 2008
1 msg
denise xifaras sequential sum of a vector... Jul 23, 2008

di jianing

Last active: Jul 17, 2008
1 msg
di jianing Can mvtnorm calculate a sequence of probabilities? Jul 17, 2008

dogle

Last active: Jul 8, 2008
1 msg
dogle Automatic placement of Legends Jul 8, 2008

domenico pestalozzi

Last active: Jul 11, 2008
1 msg
domenico pestalozzi how to test this multivariate normal distribution? Jul 11, 2008

dxc13

Last active: Jul 29, 2008
3 msgs
dxc13 simple random number generation Jul 24, 2008 dxc13 finding a faster way to do an iterative computation Jul 29, 2008 dxc13 finding a faster way to do an iterative computation Jul 29, 2008

el_eli at gmx.de

Last active: Jul 30, 2008
2 msgs
el_eli at gmx.de "non-sample" standard-deviation Jul 9, 2008 el_eli at gmx.de Eclipse/Statet: How to set breakpoints Jul 30, 2008

emir.toktar at computer.org

Last active: Jul 21, 2008
1 msg
emir.toktar at computer.org optimize function help!! Jul 21, 2008

emir.toktar at gmail.com

Last active: Jul 29, 2008
1 msg
emir.toktar at gmail.com optimize simultaneously two binomials inequalities using nlm Jul 29, 2008

ermimi

Last active: Jul 26, 2008
1 msg
ermimi Help to Text Windoes in Menu with TCL-TK Jul 26, 2008

eugen pircalabelu

Last active: Jul 14, 2008
1 msg
eugen pircalabelu Question regarding lmer vs glmmPQL vs glmm.admb model on a negative binomial distributed dependent variable Jul 14, 2008

fernanda lopez

Last active: Jul 14, 2008
1 msg
fernanda lopez Loop problem Jul 14, 2008

francogrex

Last active: Jul 23, 2008
1 msg
francogrex Calling LISP programs in R Jul 23, 2008

fzp2008

Last active: Jul 21, 2008
1 msg
fzp2008 portfolio optimization problem - use R Jul 21, 2008

g-h-d

Last active: Jul 31, 2008
1 msg
g-h-d How to abort JGR Jul 31, 2008

georgiana onicescu

Last active: Jul 31, 2008
1 msg
georgiana onicescu instal tar.gz package on windows Jul 31, 2008

giovanni parrinello

Last active: Jul 1, 2008
1 msg
giovanni parrinello Orthogonal polynomials and poly Jul 1, 2008

giuseppe1.milicia at hsbcib.com

Last active: Jul 24, 2008
1 msg
giuseppe1.milicia at hsbcib.com Problems with Rmpi and LAM 7.1.4 Jul 24, 2008

guillaume chaumet

Last active: Jul 9, 2008
1 msg
guillaume chaumet building experimental paradigm with R as "Brainard/Pelli Psych Toolbox" Jul 9, 2008

haani hanni

Last active: Jul 26, 2008
2 msgs
haani hanni how i can install Rgraphviz in R2.7.1 Jul 16, 2008 haani hanni how i can install Rgraphviz in R2.7.1 Jul 26, 2008

hesicaia

Last active: Jul 9, 2008
2 msgs
hesicaia extracting index list when using tapply() Jul 8, 2008 hesicaia extracting index list when using tapply() Jul 9, 2008

hpdutra

Last active: Jul 19, 2008
8 msgs
hpdutra interpreting mixed model anova results Jul 5, 2008 hpdutra Error: cannot use PQL when using lmer Jul 5, 2008 hpdutra What is my replication unit? Lmer for binary longitudinal data with blocks and two treaments. Jul 6, 2008 hpdutra GroupedData for three way randomized block. LME Jul 11, 2008 hpdutra ggplot2 book? Jul 12, 2008 hpdutra specifying data Jul 12, 2008 hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008 hpdutra wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008

hpdutra at yahoo.com

Last active: Jul 5, 2008
2 msgs
hpdutra at yahoo.com Error: cannot use PQL when using lmer Jul 5, 2008 hpdutra at yahoo.com Error: cannot use PQL when using lmer Jul 5, 2008

icebreake

Last active: Jul 14, 2008
2 msgs
icebreake Tissue specific genes by ANOVA? Jul 14, 2008 icebreake Tissue specific genes by ANOVA? Jul 14, 2008

iwhite@staffmail.ed.ac.uk

Last active: Jul 17, 2008
1 msg
iwhite@staffmail.ed.ac.uk model.tables standard errors Jul 17, 2008

jcarmichael

Last active: Jul 28, 2008
4 msgs
jcarmichael Using PrettyR to produce LaTeX output Jul 23, 2008 jcarmichael Using PrettyR to produce LaTeX output Jul 28, 2008 jcarmichael Using PrettyR to produce LaTeX output Jul 28, 2008 jcarmichael Negative Binomial Regression Jul 28, 2008

jim holtman

Last active: Jul 31, 2008
127 msgs
jim holtman reshape matrices Jul 1, 2008 jim holtman Change name of a specific column of a data frame Jul 1, 2008 jim holtman dev.off() inside a function & other glitches Jul 1, 2008 jim holtman Problem reading from a data frame Jul 2, 2008 jim holtman Accessing a field in a data fram Jul 2, 2008 jim holtman Insert text in data.frame Jul 2, 2008 jim holtman Migrating from S-Plus to R - Exporting Tables Jul 2, 2008 jim holtman what can we do when R gives no response Jul 2, 2008 jim holtman Problem in applying conditional looping Jul 3, 2008 jim holtman what can we do when R gives no response Jul 3, 2008 jim holtman Recoding a variable Jul 3, 2008 jim holtman by or tapply? Jul 3, 2008 jim holtman create a zero matrix & fill Jul 4, 2008 jim holtman Calling and running a compiled program inside R Jul 4, 2008 jim holtman Lots of huge matrices, for-loops, speed Jul 6, 2008 jim holtman Exception Handling Jul 7, 2008 jim holtman Plot depends on conditions Jul 7, 2008 jim holtman Basic Vector and Matrix Operations Jul 7, 2008 jim holtman extracting index list when using tapply() Jul 8, 2008 jim holtman replacing value in column of data frame Jul 9, 2008 jim holtman Parsing Jul 9, 2008 jim holtman lapply Jul 9, 2008 jim holtman Parsing Jul 9, 2008 jim holtman gsub and "\" Jul 9, 2008 jim holtman Strptime/ date time classes Jul 9, 2008 jim holtman Parsing Jul 9, 2008 jim holtman Strptime/ date time classes Jul 9, 2008 jim holtman shifting data in matrix by n rows Jul 9, 2008 jim holtman randomly select duplicated entries Jul 9, 2008 jim holtman shifting data in matrix by n rows Jul 9, 2008 jim holtman Turn any vector Jul 10, 2008 jim holtman rounding Jul 10, 2008 jim holtman Position in a vector of the last value > n Jul 10, 2008 jim holtman reading in a subset of a large data set Jul 11, 2008 jim holtman Difficultes with grep Jul 11, 2008 jim holtman plotting granular data Jul 11, 2008 jim holtman Assoociative array? Jul 12, 2008 jim holtman Position in a vector of the last value > n - *SOLVED* Jul 12, 2008 jim holtman Reading Multi-value data fields for descriptive analysis Jul 12, 2008 jim holtman Assoociative array? Jul 12, 2008 jim holtman Assoociative array? Jul 12, 2008 jim holtman Assoociative array? Jul 13, 2008 jim holtman Reading Multi-value data fields for descriptive analysis Jul 13, 2008 jim holtman (no subject) Jul 13, 2008 jim holtman Assoociative array? Jul 13, 2008 jim holtman Difficultes with grep Jul 13, 2008 jim holtman any way to set defaults for par? Jul 13, 2008 jim holtman Reading Multi-value data fields for descriptive analysis Jul 13, 2008 jim holtman applying complex functions by groups Jul 14, 2008 jim holtman Convert data set to data frame Jul 14, 2008 jim holtman Assoociative array? Jul 14, 2008 jim holtman long data frame selection error Jul 15, 2008 jim holtman Assoociative array? Jul 15, 2008 jim holtman Filtering output Jul 15, 2008 jim holtman Melt (reshape) question Jul 15, 2008 jim holtman code reduction (if anyone feels like it) Jul 15, 2008 jim holtman tryCatch - return from function to main script Jul 15, 2008 jim holtman code reduction (if anyone feels like it) Jul 15, 2008 jim holtman code reduction (if anyone feels like it) Jul 15, 2008 jim holtman Group level frequencies Jul 16, 2008 jim holtman Mapping data onto score Jul 16, 2008 jim holtman Help regarding arules package Jul 16, 2008 jim holtman Histogram with two colors depending on condition Jul 17, 2008 jim holtman float and double precision with C code Jul 17, 2008 jim holtman help with data layout Jul 17, 2008 jim holtman Display variables when running a script Jul 17, 2008 jim holtman Function to create variables with prefix Jul 17, 2008 jim holtman manipulate a matrix2 Jul 18, 2008 jim holtman Landscape mode for pdf Jul 18, 2008 jim holtman histogram plot default Jul 18, 2008 jim holtman with lapply() how can you retrieve the name of the object Jul 18, 2008 jim holtman with lapply() how can you retrieve the name of the object Jul 18, 2008 jim holtman problem with putting text in outer margins (mtext outer=TRUE) Jul 18, 2008 jim holtman Calculating Betweenness - Efficiency problem Jul 19, 2008 jim holtman Change font-face in title Jul 19, 2008 jim holtman Title for graph with multiple plots Jul 19, 2008 jim holtman Calculating Betweenness - Efficiency problem Jul 19, 2008 jim holtman replicate matrix blocks different numbers of times into new matrix Jul 19, 2008 jim holtman problem with read.table Jul 20, 2008 jim holtman R interprets symbol as q() Jul 20, 2008 jim holtman Order of columns(variables) in dataframe Jul 20, 2008 jim holtman Error in edit(name,file,title,editor) Jul 20, 2008 jim holtman Access to values of function arguments Jul 20, 2008 jim holtman Erro: cannot allocate vector of size 216.0 Mb Jul 20, 2008 jim holtman enumerate subsets Jul 20, 2008 jim holtman Sum efficiently from large matrix according to re-occuring levels of factor? Jul 20, 2008 jim holtman sampling from a list of values while excluding one Jul 21, 2008 jim holtman manipulate a matrix2 Jul 21, 2008 jim holtman On creating grouped data set. Jul 21, 2008 jim holtman manipulate a matrix2 Jul 21, 2008 jim holtman Help with rearranging data Jul 22, 2008 jim holtman How to.... Jul 22, 2008 jim holtman average replicate probe values Jul 23, 2008 jim holtman adding the mean and standard deviation to boxplots Jul 23, 2008 jim holtman Using if, else statements Jul 23, 2008 jim holtman Using if, else statements Jul 23, 2008 jim holtman Using if, else statements Jul 23, 2008 jim holtman Q re iterating a process and appending results to output file Jul 23, 2008 jim holtman average replicate probe values Jul 23, 2008 jim holtman simple random number generation Jul 24, 2008 jim holtman Write lower half of distance matrix only Jul 25, 2008 jim holtman Write lower half of distance matrix only Jul 25, 2008 jim holtman Matrix from List Jul 25, 2008 jim holtman Selecting the first measurement only from a longitudinal sequence Jul 25, 2008 jim holtman Help with matrix Jul 25, 2008 jim holtman Simple vector question. Jul 25, 2008 jim holtman error in test Jul 25, 2008 jim holtman Simple vector question. Jul 26, 2008 jim holtman Can't get the correct order from melt.data.frame of reshape library. Jul 26, 2008 jim holtman Marking Interval Length Jul 26, 2008 jim holtman Sample Jul 26, 2008 jim holtman Marking Interval Length Jul 26, 2008 jim holtman Coarsening the Resolution of a Dataset Jul 26, 2008 jim holtman Analyzing Intervals between Data Jul 26, 2008 jim holtman Analyzing Intervals between Data Jul 26, 2008 jim holtman Analyzing Intervals between Data Jul 26, 2008 jim holtman Using stop ( ) from a Text Editor Jul 28, 2008 jim holtman product of successive rows Jul 28, 2008 jim holtman speeding up loop and dealing wtih memory problems Jul 28, 2008 jim holtman list Jul 29, 2008 jim holtman ls() and memory question Jul 29, 2008 jim holtman Coarsening the Resolution of a Dataset Jul 29, 2008 jim holtman how to get the position of a vector-value Jul 29, 2008 jim holtman Is there a better way to check if an element of a list exists than using match on names? Jul 29, 2008 jim holtman Coarsening the Resolution of a Dataset Jul 30, 2008 jim holtman need some help Jul 30, 2008 jim holtman Coarsening the Resolution of a Dataset Jul 31, 2008

jimineep

Last active: Jul 4, 2008
1 msg
jimineep Re ad in a file - produce independent vectors Jul 4, 2008

john seers (IFR)

Last active: Jul 31, 2008
8 msgs
john seers (IFR) false discovery rate ! Jul 10, 2008 john seers (IFR) false discovery rate ! Jul 14, 2008 john seers (IFR) par() function does not work Jul 23, 2008 john seers (IFR) par() function does not work Jul 23, 2008 john seers (IFR) Simple... but... Jul 23, 2008 john seers (IFR) Is there an equivalent * operator? Jul 24, 2008 john seers (IFR) Just 2 more questions - for now! Jul 24, 2008 john seers (IFR) add string Jul 31, 2008

jonboym

Last active: Jul 8, 2008
1 msg
jonboym Multiple Plots and y Axis Labels Jul 8, 2008

joseph

Last active: Jul 28, 2008
3 msgs
joseph 64-bit R on Mac OS X 10.4.5 Jul 25, 2008 joseph 64-bit R on Mac OS X 10.5.4 Jul 27, 2008 joseph 64-bit R on Mac OS X 10.5.4 Jul 28, 2008

jp d

Last active: Jul 16, 2008
1 msg
jp d create a function from a model Jul 16, 2008

jpl

Last active: Jul 2, 2008
1 msg
jpl question on dispersion parameter Jul 2, 2008

kayj

Last active: Jul 30, 2008
1 msg
kayj barplot for a categorial variable Jul 30, 2008

kende jan

Last active: Jul 5, 2008
1 msg
kende jan Bland-Altman method to measure agreement with repeated measures Jul 5, 2008

korhan ozkan

Last active: Jul 13, 2008
1 msg
korhan ozkan rm anova Jul 13, 2008

l y

Last active: Jul 6, 2008
1 msg
l y Hi~problem with the two sample test: ks2Test in the package of fbasics Jul 6, 2008

laila khalfan

Last active: Jul 28, 2008
9 msgs
laila khalfan For loop Jul 3, 2008 laila khalfan For loop Jul 3, 2008 laila khalfan For loop Jul 3, 2008 laila khalfan need help in parametric bootstrap Jul 25, 2008 laila khalfan parametric bootstrap Jul 25, 2008 laila khalfan parametric bootstrap Jul 25, 2008 laila khalfan parametric bootstrap Jul 26, 2008 laila khalfan parametric bootstrap Jul 28, 2008 laila khalfan Bootstrapping Jul 28, 2008

lamack lamack

Last active: Jul 20, 2008
2 msgs
lamack lamack Stratified random sample Jul 16, 2008 lamack lamack enumerate subsets Jul 20, 2008

larry88

Last active: Jul 15, 2008
1 msg
larry88 how to get confidential interval for classification accuracy using 10-fold validation in svm package Jul 15, 2008

ldb

Last active: Jul 25, 2008
1 msg
ldb extracting Pr>ltl from robcov/ols (Design) Jul 25, 2008

leeznar

Last active: Jul 9, 2008
1 msg
leeznar “Check” problem Jul 9, 2008

marciarr

Last active: Jul 11, 2008
1 msg
marciarr Start preferred RGui Jul 11, 2008

maria at meteo.mcgill.ca

Last active: Jul 21, 2008
2 msgs
maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 11, 2008 maria at meteo.mcgill.ca TeachingDemos question: my.symbols() alignment problems in complicated layout Jul 21, 2008

martin.gaston at unavarra.es

Last active: Jul 2, 2008
1 msg
martin.gaston at unavarra.es Goodness of fit test Jul 2, 2008

melanie.r

Last active: Jul 8, 2008
1 msg
melanie.r simulate data for lme Jul 8, 2008

mergullo

Last active: Jul 30, 2008
1 msg
mergullo model mix problem. FALSE CONVERGENCE Jul 30, 2008

mfrumin

Last active: Jul 31, 2008
3 msgs
mfrumin bug in 'margins' behavior in reshape - cast Jul 30, 2008 mfrumin bug in 'margins' behavior in reshape - cast Jul 30, 2008 mfrumin bug in 'margins' behavior in reshape - cast Jul 31, 2008

milicic.marko

Last active: Jul 19, 2008
2 msgs
milicic.marko Discretize continous variables.... Jul 19, 2008 milicic.marko Discretize continous variables.... Jul 19, 2008

milton ruser

Last active: Jul 30, 2008
21 msgs
milton ruser trying to superimpose a line plot onto a histogram Jul 5, 2008 milton ruser Numbers as Points in Graphs Jul 6, 2008 milton ruser Numbers as Points in Graphs Jul 6, 2008 milton ruser Sorting a list Jul 7, 2008 milton ruser package segmented problem Jul 9, 2008 milton ruser question about a small "for" loop Jul 14, 2008 milton ruser wroung groupedData despite reading Bates and Pinheiro 3 times Jul 19, 2008 milton ruser estimating volume from xyz points Jul 19, 2008 milton ruser How to filter a data frame? Jul 22, 2008 milton ruser an extremely simple question Jul 22, 2008 milton ruser Can't Load Text Files Jul 22, 2008 milton ruser Using if, else statements Jul 23, 2008 milton ruser Using if, else statements Jul 23, 2008 milton ruser Histogram Jul 23, 2008 milton ruser sum each row and output results Jul 23, 2008 milton ruser Sample on dataframe Jul 23, 2008 milton ruser Histogram Jul 23, 2008 milton ruser How to preserve the numeric format and digits ? Jul 24, 2008 milton ruser Insert rows into a pre-existing data frame Jul 25, 2008 milton ruser response surface analysis Jul 26, 2008 milton ruser multiple separators in scan() functions Jul 30, 2008

mm745 at st-andrews.ac.uk

Last active: Jul 27, 2008
4 msgs
mm745 at st-andrews.ac.uk "Invalid object" error in boxplot Jul 1, 2008 mm745 at st-andrews.ac.uk Problem with GLS dwtest function Jul 24, 2008 mm745 at st-andrews.ac.uk GLS "no terms component" error Jul 26, 2008 mm745 at st-andrews.ac.uk GLS "no terms component" error Jul 27, 2008

muhammad faisal

Last active: Jul 11, 2008
3 msgs
muhammad faisal How I count the all possible samples?? Jul 8, 2008 muhammad faisal calculation of entropy in R??? Jul 8, 2008 muhammad faisal Any R package about COALESCENT THEORY/GENEOLOGICAL TREES?? Jul 11, 2008

mysimbaa

Last active: Jul 18, 2008
11 msgs
mysimbaa Add comments on plot window Jul 1, 2008 mysimbaa if one of 4 conditions is not satisfied Jul 1, 2008 mysimbaa if one of 4 conditions is not satisfied Jul 1, 2008 mysimbaa initialize a matrix Jul 4, 2008 mysimbaa initialize a matrix Jul 4, 2008 mysimbaa Error while plotting matrix Jul 4, 2008 mysimbaa Plot depends on conditions Jul 7, 2008 mysimbaa Plot depends on conditions Jul 10, 2008 mysimbaa eval.wih.vis Jul 14, 2008 mysimbaa eval.wih.vis Jul 15, 2008 mysimbaa re ad and check table Jul 18, 2008

naw3 at duke.edu

Last active: Jul 30, 2008
9 msgs
naw3 at duke.edu Ignore blank columns when reading a row from a table Jul 1, 2008 naw3 at duke.edu Change name of a specific column of a data frame Jul 1, 2008 naw3 at duke.edu Problem reading from a data frame Jul 2, 2008 naw3 at duke.edu Help with an error message Jul 14, 2008 naw3 at duke.edu Display variables when running a script Jul 17, 2008 naw3 at duke.edu Decoding subscripts/superscripts from CSVs Jul 22, 2008 naw3 at duke.edu Help with which() Jul 24, 2008 naw3 at duke.edu Insert rows into a pre-existing data frame Jul 25, 2008 naw3 at duke.edu Converting to subscripts and superscripts Jul 30, 2008

nicholasw22

Last active: Jul 1, 2008
1 msg
nicholasw22 Install Packages in Windows Vista Jul 1, 2008

nmarti

Last active: Jul 30, 2008
8 msgs
nmarti Summary Stats (not summary(x)) Jul 9, 2008 nmarti Summary Stats (not summary(x)) Jul 9, 2008 nmarti Summary Stats (not summary(x)) Jul 9, 2008 nmarti Summary Stats (not summary(x)) Jul 9, 2008 nmarti Dividing by 0 Jul 24, 2008 nmarti Dividing by 0 Jul 25, 2008 nmarti Rprintf will not build in my C++ compiler Jul 30, 2008 nmarti Rprintf will not build in my C++ compiler Jul 30, 2008

olvrmrs at aol.com

Last active: Jul 17, 2008
1 msg
olvrmrs at aol.com combining lists of pairs Jul 17, 2008

oscar Linares

Last active: Jul 27, 2008
2 msgs
oscar Linares Manipulate Data (with regular expressions) Jul 8, 2008 oscar Linares Converting english words to numeric equivalents Jul 27, 2008

otunno at CLEMSON.EDU

Last active: Jul 9, 2008
1 msg
otunno at CLEMSON.EDU question on FARIMA innovations Jul 9, 2008

pacomet

Last active: Jul 30, 2008
2 msgs
pacomet About clustering techniques Jul 29, 2008 pacomet About clustering techniques Jul 30, 2008

paulandpen

Last active: Jul 24, 2008
2 msgs
paulandpen Excel Trend Function Jul 13, 2008 paulandpen error with .dll file and RGtk2 Jul 24, 2008

pgseye

Last active: Jul 25, 2008
3 msgs
pgseye Write lower half of distance matrix only Jul 25, 2008 pgseye Write lower half of distance matrix only Jul 25, 2008 pgseye Write lower half of distance matrix only Jul 25, 2008

phguardiol at aol.com

Last active: Jul 26, 2008
2 msgs
phguardiol at aol.com competing risk model with time dependent covariates Jul 26, 2008 phguardiol at aol.com question about cmprsk library Jul 26, 2008

phoebe kong

Last active: Jul 9, 2008
2 msgs
phoebe kong Read.table - Less rows than original data Jul 9, 2008 phoebe kong read.table problem Jul 9, 2008

poolloopus at yahoo.com

Last active: Jul 1, 2008
1 msg
poolloopus at yahoo.com WIERD: Basic computing in R Jul 1, 2008

rcoder

Last active: Jul 31, 2008
25 msgs
rcoder shifting data in matrix by n rows Jul 9, 2008 rcoder shifting data in matrix by n rows Jul 9, 2008 rcoder shifting data in matrix by n rows Jul 10, 2008 rcoder shifting data in matrix by n rows Jul 10, 2008 rcoder Mapping data onto 1-10 score Jul 15, 2008 rcoder Mapping data onto score Jul 15, 2008 rcoder Mapping data onto score Jul 15, 2008 rcoder Mapping data onto score Jul 15, 2008 rcoder Mapping data onto score Jul 16, 2008 rcoder Mapping data onto score Jul 16, 2008 rcoder Rolling range and regression calculations Jul 24, 2008 rcoder Rolling range and regression calculations Jul 25, 2008 rcoder Rolling range and regression calculations Jul 25, 2008 rcoder product of successive rows Jul 27, 2008 rcoder Rolling regression - o/p selected coefficients Jul 27, 2008 rcoder rollapply() opertation on ts matrix Jul 28, 2008 rcoder rollapply() opertation on time series Jul 28, 2008 rcoder rollapply() opertation on time series Jul 29, 2008 rcoder correlation between matrices - both with some NAs Jul 29, 2008 rcoder rolling regression between adjacent columns Jul 29, 2008 rcoder Re gression between columns in matrix - with some/full NAs Jul 30, 2008 rcoder rolling regression between adjacent columns Jul 30, 2008 rcoder Re gression between adjacent columns - error with NAs Jul 30, 2008 rcoder Re gression between adjacent columns - error with NAs Jul 31, 2008 rcoder rollapply() to portions of a matrix Jul 31, 2008

renata.camargo05 at ntlworld.com

Last active: Jul 30, 2008
5 msgs
renata.camargo05 at ntlworld.com stringdot ? Jul 29, 2008 renata.camargo05 at ntlworld.com ~ . help Jul 30, 2008 renata.camargo05 at ntlworld.com Need help Jul 30, 2008 renata.camargo05 at ntlworld.com FFT - (STATS) - is this correct? Jul 30, 2008 renata.camargo05 at ntlworld.com FOURIER TRANSFORM HELP Jul 30, 2008

rhelp.20.trevva at spamgourmet.com

Last active: Jul 22, 2008
2 msgs
rhelp.20.trevva at spamgourmet.com Parameter names in nls Jul 21, 2008 rhelp.20.trevva at spamgourmet.com Parameter names in nls Jul 22, 2008

rkevinburton at charter.net

Last active: Jul 29, 2008
32 msgs
rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Installing RWinEdt Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 12, 2008 rkevinburton at charter.net Assoociative array? Jul 13, 2008 rkevinburton at charter.net Installing RWinEdt Jul 13, 2008 rkevinburton at charter.net Assoociative array? Jul 14, 2008 rkevinburton at charter.net Assoociative array? Jul 14, 2008 rkevinburton at charter.net Assoociative array? Jul 15, 2008 rkevinburton at charter.net Assoociative array? Jul 15, 2008 rkevinburton at charter.net Assoociative array? Jul 15, 2008 rkevinburton at charter.net Iterations Jul 15, 2008 rkevinburton at charter.net Iterations Jul 15, 2008 rkevinburton at charter.net Iterations Jul 15, 2008 rkevinburton at charter.net Filtering output Jul 15, 2008 rkevinburton at charter.net smooth.spline Jul 17, 2008 rkevinburton at charter.net smooth.spline Jul 19, 2008 rkevinburton at charter.net smooth.spline Jul 20, 2008 rkevinburton at charter.net Simple vector question. Jul 25, 2008 rkevinburton at charter.net Simple vector question. Jul 25, 2008 rkevinburton at charter.net Beginning lm Jul 26, 2008 rkevinburton at charter.net Data length mismatch. Jul 26, 2008 rkevinburton at charter.net Complex to polar? Jul 27, 2008 rkevinburton at charter.net Retain plot? Jul 27, 2008 rkevinburton at charter.net Help interpreting density(). Jul 28, 2008 rkevinburton at charter.net Help interpreting density(). Jul 29, 2008 rkevinburton at charter.net Help interpreting density(). Jul 29, 2008 rkevinburton at charter.net Help interpreting density(). Jul 29, 2008

rlearner309

Last active: Jul 28, 2008
13 msgs
rlearner309 A regression problem using dummy variables Jul 1, 2008 rlearner309 A regression problem using dummy variables Jul 1, 2008 rlearner309 A regression problem using dummy variables Jul 2, 2008 rlearner309 A regression problem using dummy variables Jul 2, 2008 rlearner309 A regression problem using dummy variables Jul 3, 2008 rlearner309 A quick question about lm() Jul 7, 2008 rlearner309 Can I do regression by steps? Jul 8, 2008 rlearner309 Can I do regression by steps? Jul 8, 2008 rlearner309 How to filter a data frame? Jul 22, 2008 rlearner309 Does R have SQL interface in windows? Jul 22, 2008 rlearner309 How to filter a data frame? Jul 22, 2008 rlearner309 How to control the memory? Jul 23, 2008 rlearner309 how to add notes to the graph? Jul 28, 2008

rnoob

Last active: Jul 13, 2008
1 msg
rnoob Using Internals via their compiled sources Jul 13, 2008

robert.ptacnik at niva.no

Last active: Jul 4, 2008
1 msg
robert.ptacnik at niva.no kriging problem(?) Jul 4, 2008

runner

Last active: Jul 7, 2008
1 msg
runner list genes w/n a genomic fragment Jul 7, 2008

shetumi at aim.com

Last active: Jul 17, 2008
2 msgs
shetumi at aim.com size and coding error in plot ? Jul 17, 2008 shetumi at aim.com size and coding error in plot ? Jul 17, 2008

silvia narduzzi

Last active: Jul 25, 2008
5 msgs
silvia narduzzi problem Jul 16, 2008 silvia narduzzi errors using step function Jul 17, 2008 silvia narduzzi errors using step function Jul 18, 2008 silvia narduzzi maximum likelihood method to fit a model Jul 23, 2008 silvia narduzzi cannot allocate vector of size... Jul 25, 2008

sj

Last active: Jul 18, 2008
3 msgs
sj data summerization etc... Jul 11, 2008 sj data summarization etc... Jul 11, 2008 sj using which to identify a range of values Jul 18, 2008

sprohl at na.uni-tuebingen.de

Last active: Jul 9, 2008
2 msgs
sprohl at na.uni-tuebingen.de specifying data Jul 9, 2008 sprohl at na.uni-tuebingen.de Interpolation of data Jul 9, 2008

squall44

Last active: Jul 8, 2008
1 msg
squall44 shading an area in a edf Jul 8, 2008

ss

Last active: Jul 8, 2008
1 msg
ss How to draw dot plots for 2 vectors seperately Jul 8, 2008

stefano iacus

Last active: Jul 16, 2008
1 msg
stefano iacus R logo Jul 16, 2008

stephanos

Last active: Jul 1, 2008
1 msg
stephanos Prediction with Bayesian Network? Jul 1, 2008

stephen sefick

Last active: Jul 31, 2008
78 msgs
stephen sefick Fitting a curve to data Jul 1, 2008 stephen sefick Fitting a curve to data Jul 1, 2008 stephen sefick Fitting a curve to data Jul 1, 2008 stephen sefick Area Under a Curve Jul 1, 2008 stephen sefick plot.zoo labels Jul 1, 2008 stephen sefick Zoo plotting behavior Jul 2, 2008 stephen sefick Zoo plotting behavior Jul 2, 2008 stephen sefick Zoo plotting behavior Jul 2, 2008 stephen sefick Zoo plotting behavior Jul 2, 2008 stephen sefick Zoo plotting behavior Jul 2, 2008 stephen sefick Multiple time series plots Jul 2, 2008 stephen sefick subset() multiple arguments Jul 7, 2008 stephen sefick time series by calendar week Jul 8, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008 stephen sefick Plot Jul 8, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008 stephen sefick Automatic placement of Legends Jul 8, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 8, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 9, 2008 stephen sefick making zoo objects with zoo without format argument? Jul 9, 2008 stephen sefick outlining symbol in legend with blackline Jul 9, 2008 stephen sefick rollmean() Jul 9, 2008 stephen sefick zoo and cex Jul 9, 2008 stephen sefick Interpolation of data Jul 10, 2008 stephen sefick creating axis of the plot before data are plotted Jul 14, 2008 stephen sefick Help with an error message Jul 14, 2008 stephen sefick creating axis of the plot before data are plotted Jul 14, 2008 stephen sefick manipulating (extracting) data from distance matrices Jul 15, 2008 stephen sefick Calculating Stream Metabolism Jul 15, 2008 stephen sefick sunrise sunset calculations Jul 15, 2008 stephen sefick sunrise sunset calculations Jul 15, 2008 stephen sefick Help with maptools sunriset() Jul 15, 2008 stephen sefick code reduction (if anyone feels like it) Jul 15, 2008 stephen sefick POSIXct extract time Jul 15, 2008 stephen sefick POSIXct extract time Jul 15, 2008 stephen sefick code reduction (if anyone feels like it) Jul 15, 2008 stephen sefick code reduction (if anyone feels like it) Jul 16, 2008 stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008 stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008 stephen sefick finding "chuncks" of data that have no NA s Jul 18, 2008 stephen sefick source code functions Jul 18, 2008 stephen sefick extracting colnames to label plots in a function Jul 19, 2008 stephen sefick extracting colnames to label plots in a function Jul 19, 2008 stephen sefick extracting colnames to label plots in a function Jul 19, 2008 stephen sefick extracting colnames to label plots in a function Jul 19, 2008 stephen sefick saving plot both as jpg and pdf Jul 22, 2008 stephen sefick rollmean and stl Jul 22, 2008 stephen sefick .asp (not really an R question) but related Jul 22, 2008 stephen sefick Editor for Mac Jul 23, 2008 stephen sefick Just 2 more questions - for now! Jul 24, 2008 stephen sefick Question: how to build a subset to do separate calculations Jul 24, 2008 stephen sefick Question: how to build a subset to do separate calculations Jul 24, 2008 stephen sefick Should this PDF render correctly without font embedding? Jul 24, 2008 stephen sefick Rolling range and regression calculations Jul 25, 2008 stephen sefick Scatterplot matrix one column vs. the rest of the dataset Jul 25, 2008 stephen sefick Scatterplot matrix one column vs. the rest of the dataset Jul 25, 2008 stephen sefick "Multiple" Regressions indexed by goodness of fit Jul 25, 2008 stephen sefick plot zoo custom panel help Jul 25, 2008 stephen sefick plot zoo custom panel help Jul 25, 2008 stephen sefick Rolling range and regression calculations Jul 25, 2008 stephen sefick create multi windows plot at the same time Jul 25, 2008 stephen sefick plot zoo custom panel help Jul 25, 2008 stephen sefick Numerical question Jul 25, 2008 stephen sefick Interpolating a line and then summing there values for a diurnal oxygen curve (zoo object) Jul 27, 2008 stephen sefick writing the plots Jul 28, 2008 stephen sefick Overlay of simple plots Jul 28, 2008 stephen sefick combining zoo series with an overlapping index? Jul 29, 2008 stephen sefick combining zoo series with an overlapping index? Jul 29, 2008 stephen sefick combining zoo series with an overlapping index? Jul 29, 2008 stephen sefick combining zoo series with an overlapping index? Jul 29, 2008 stephen sefick FFT - (STATS) - is this correct? Jul 30, 2008 stephen sefick john chambers R book Jul 30, 2008 stephen sefick S 3 generic method consistency warning please help Jul 30, 2008 stephen sefick S 3 generic method consistency warning please help Jul 30, 2008 stephen sefick S 3 generic method consistency warning please help Jul 30, 2008 stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Jul 31, 2008 stephen sefick Is R's fast fourier transform function different from "fft2" in Matlab? Jul 31, 2008

stoffer@pitt.edu

Last active: Jul 11, 2008
2 msgs
stoffer@pitt.edu Comparing complex numbers Jul 11, 2008 stoffer@pitt.edu Comparing complex numbers Jul 11, 2008

sue at xlsolutions-corp.com

Last active: Jul 22, 2008
1 msg
sue at xlsolutions-corp.com 2 Courses*** R/Splus Advanced Programming : August 14-15 in Seattle ! by XLSolutions Corp Jul 22, 2008

svga at arcor.de

Last active: Jul 30, 2008
2 msgs
svga at arcor.de Most often pairs of chars across grouping variable Jul 29, 2008 svga at arcor.de Most often pairs of chars across grouping variable Jul 30, 2008

t03eh7 at abdn.ac.uk

Last active: Jul 2, 2008
2 msgs
t03eh7 at abdn.ac.uk Correlation structures in gls with repeated measurements Jul 2, 2008 t03eh7 at abdn.ac.uk Correlation structures in gls with repeated measurements Jul 2, 2008

theBenjamin

Last active: Jul 14, 2008
3 msgs
theBenjamin Ternaryplot function Jul 3, 2008 theBenjamin Plot multiple datasets on a VCD ternary graph Jul 11, 2008 theBenjamin Extract and plot array from data Jul 14, 2008

threshold

Last active: Jul 6, 2008
1 msg
threshold ts.plot Jul 6, 2008

tolga.i.uzuner at jpmorgan.com

Last active: Jul 22, 2008
22 msgs
tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008 tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008 tolga.i.uzuner at jpmorgan.com Optimal lag selection in Granger Causality tests Jul 2, 2008 tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 2, 2008 tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 3, 2008 tolga.i.uzuner at jpmorgan.com Problem with strucchange package Jul 4, 2008 tolga.i.uzuner at jpmorgan.com Sorting a list Jul 7, 2008 tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 8, 2008 tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 9, 2008 tolga.i.uzuner at jpmorgan.com Automatic placement of Legends Jul 9, 2008 tolga.i.uzuner at jpmorgan.com options() question for displaying numbers in the GUI Jul 14, 2008 tolga.i.uzuner at jpmorgan.com options() question for displaying numbers in the GUI Jul 14, 2008 tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Jul 15, 2008 tolga.i.uzuner at jpmorgan.com Supressing printing from a function: ecdf Jul 15, 2008 tolga.i.uzuner at jpmorgan.com creating names for lists Jul 18, 2008 tolga.i.uzuner at jpmorgan.com creating names for lists Jul 18, 2008 tolga.i.uzuner at jpmorgan.com Landscape mode for pdf Jul 18, 2008 tolga.i.uzuner at jpmorgan.com Landscape mode for pdf Jul 18, 2008 tolga.i.uzuner at jpmorgan.com Non-linearly constrained optimisation Jul 19, 2008 tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008 tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008 tolga.i.uzuner at jpmorgan.com normalised/transformed regressions Jul 22, 2008

tom soyer

Last active: Jul 27, 2008
1 msg
tom soyer help with durbin.watson Jul 27, 2008

willemf

Last active: Jul 20, 2008
5 msgs
willemf Font quality in base graphics Jul 15, 2008 willemf Font quality in base graphics Jul 15, 2008 willemf Font quality in base graphics Jul 16, 2008 willemf Access to values of function arguments Jul 20, 2008 willemf Access to values of function arguments Jul 20, 2008

wmh

Last active: Jul 3, 2008
1 msg
wmh Random effects and lme4 Jul 3, 2008

xiaopeng hu

Last active: Jul 28, 2008
1 msg
xiaopeng hu I can not see help.start() in Ubuntu. Jul 28, 2008

zerfetzen

Last active: Jul 28, 2008
2 msgs
zerfetzen Legality Question about R's Open Source GNU GPL License Jul 28, 2008 zerfetzen Legality Question about R's Open Source GNU GPL License Jul 28, 2008

刘杰

Last active: Jul 21, 2008
2 msgs
刘杰 logistic regreesion and score test Jul 4, 2008 刘杰 Coefficients of Logistic Regression from bootstrap - how to get them? Jul 21, 2008

程燕

Last active: Jul 1, 2008
1 msg
程燕 how to estimate the parameters in a bivariate weibull distribution? Jul 1, 2008

闫梅

Last active: Jul 22, 2008
1 msg
闫梅 select significant variables Jul 22, 2008